DNA

Part:BBa_K4274008

Designed by: Jiawen Chen   Group: iGEM22_KEYSTONE   (2022-09-30)
Revision as of 04:52, 12 October 2022 by EmmaChen (Talk | contribs)


sfp_target(gRNA) tcgggaagatcagggatgca

Guide RNA (gRNA) is used as a molecule that helps with the cleavage of DNA since it guides the Cas nuclease to a targeted dsDNA sequence. As a gRNA, sfp_target is used for knocking-out the natural, invalid sfp gene, and then knocking-in sfp (Part number:BBa_K4274009) and degQ(Part number:BBa_K4274010) gene in the genome of Bacillus subtilis.

Usage and biology

Single-guide RNA (sgRNA) is RNA designed artifially to be able to bind to a DNA sequence. It combines with the Cas9 protein to work to cleave the target RNA and though it is slightly shorter, it has the same function as the original RNAs in the CRISPR/Cas9 system. We designed the sfp_target(gRNA) to target the region of the natural sfp gene to knock-out and simultaneously knock-in sfp (Part number:BBa_K4274009) and degQ (Part number:BBa_K4274010) gene in situ. After the sucessful modification, Bacillus subtilis 168 was allowed to produce fengycins. This could be reused by other teams to edit the genome of Bacillus subtilis and thus realize fengycins’ production.

Source

Bacillus subtilis


[edit]
Categories
Parameters
None