Part:BBa_K4197004

Ara h 2 expression at the surface of E. coli cells sortable by FACS using mRFP1

Brick expressing Ara h 2 at the surface of E. coli cell sortable by FACS

Introduction

The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of arachid Ara h 2 (K4197008) on the surface of E. coli. Expression of mRFP1 is driven by the ihfb800 promoter (see K41970012). This red fluorescence is destined to identify the allergen expressing cells by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ara h 2 (K4197008) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 3046 bp with RFP and 1454 bp without.

Figure 1: Verification of the insertion of RFP fragment in Ara h 2 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colonies 1, 2 and 3 have shown the right size.

Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1280 and 6791 bp for Ara h 2.

Figure 2: Digestion by NotI of Ara h 2 with mRFP1 insertion. The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colonies 21 and 23 present the correct size for Ara h 2.

Validation

This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP1 sequence which does not allow us to continue further with this construction.

DAISY Project

DAISY (INSA-UPS 2022)

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
12
INCOMPATIBLE WITH RFC[12]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697
21
INCOMPATIBLE WITH RFC[21]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706
23
INCOMPATIBLE WITH RFC[23]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
25
INCOMPATIBLE WITH RFC[25]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472
1000
INCOMPATIBLE WITH RFC[1000]
Illegal SapI.rc site found at 2368