Part:BBa_K3930003
α-ionone induction system and expression in Saccharomyces cerevisiae (pViolette)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1265
Illegal BglII site found at 1795
Illegal BamHI site found at 1379
Illegal BamHI site found at 3518
Illegal BamHI site found at 4370
Illegal XhoI site found at 73 - 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 5805
Illegal PstI site found at 5798 - 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 5805
Illegal PstI site found at 5798
Illegal NgoMIV site found at 5303
Illegal AgeI site found at 606
Illegal AgeI site found at 5021 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 4761
Introduction
The pVIOLETTE part (BBa_K3930003) enables the production of α-ionone from lycopene and is composed by:
- the up (BBa_K3930021) and down (BBa_K3930022) integration sites in the XII-4 locus of the S.cerevisiae genome (based on the plasmid pCfB3040 from Easyclone Marker free kit (Jessop-Fabre et al.,2016))
- the LcyE-ofCCD1 enzymatic fusion (BBa_K3930024) that allows the production of α-ionone. The sequences were codon optimized for an expression into S.cereviesiae
- the inducible promoters Gal 1 with galactose (BBa_K3930023), driving the expression of LcyE-phCCD1
- the resistance marker NsrR (BBa_K3930025) to select yeast integrants
Construction
IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with an In-Fusion Takara kit into the pCfB3040 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone 3.
The plasmid containing the pVIOLETTE construct was then linearized with the F and R linearization primers pVIOLETTE. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of PCR on colony to verify clones.The expected size was obtained for clone 2.
Primer used to clone this part in the pCfB3040:
- pVIOLETTE_pCfB3040_Forward : 5' cgcccttattcgactctatag 3'
- pVIOLETTE_pCfB3040_Reverse : 5' cgtacctggatggtcatttc 3'
pVIOLETTE insert at locus XII-4 was successful. The integrant strain was named LycoYeast-pVIOLETTE and saved as glycerol stock.
Characterisation
Production of α-ionone
After verifying the correct integration of our constructs by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (red) to carotenes (orange).
Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pVIOLETTE strain plated on a YPGal Petri dish shows a yellow coloration, indicating the degradation of lycopene into ε-carotene.
The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after this lysis was analyzed by RP-HPLC using a C18 column.In the LycoYeast-pVIOLETTE strains, Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of pVIOLETTE strains, as well as the in-line following α-ionone production results, this new peak most likely corresponds to ε-carotene, the expected precursor.
The α-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-VIOLETTE strain. A peak can be observed at the same retention time as the α-ionone standard for the induced LycoYeast-VIOLETTE strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The α-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology).The production of alpha-ionone, the main molecule of the violet odour, was successfully achieved with this construction.
Conclusion and Perspectives
These results show that pVIOLETTE has the ability to degrade lycopene into ε-carotene and futher transform it into the α-ionone. The quantification of α-ionone production remains to be determined under the optimal conditions for the production of the molecule of interest.
The α-ionone belongs to the terpene family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.
References
- Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
- Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
- López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.
None |