Coding
Part:BBa_K2926000
Designed by: Ina Schmitt Group: iGEM19_Bielefeld-CeBiTec (2019-10-15)
Cas13a Lsh
This part codes for Cas13a derived from Leptotrichia shahii.
<img style="width:400px" src="
" alt="">
<figcaption>SDS-PAGEof purified Cas13a proteins Lsh, Lbu and Lwa. Marked bands indicate the further used proteins bands for analysis by MALDI-ToF MS/MS.</figcaption>
</figure>
To further analyze the expressed Cas proteins and compare them to the expected protein sequence, the marked bands were excised from the SDS-PAGE, washed, digested with trypsine and analyzed in a MALDI-ToF MS/MS. The generated mass spectra and mass lists were evaluated using the software BioTools.
<img style="width:400px" src="
" alt="">
<figcaption>Mass spectrum of the proteins Cas13a Lbu (1) and Cas13a Lsh (2) after tryptic digestcompared to the theoretical mass spectrum. Excised bands from the SDS-PAGE of Cas13a Lbu and Cas13a Lsh were washed, digested over night with trypsine and co-cristallyzed with a α-Cyano-4-hydoxycinnamic acid-matrix on a MALDI target. The mass spectrum was recorded in a MALDI-ToF MS from Bruker Daltronics and data was evaluated using the software BioTools. </figcaption>
</figure>
Using this technique, we successfully confirmed that Cas13a Lbu and Lsh were expressed and purified from the expression strain. For the Cas13a activity in-vitro assay we designed single guide RNAs (gRNAs) targeting a RFP gene. The following gRNA was ordered via RNA synthesis from IDT.
CAAAGCTTACGTTAAACACCCGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC
<figure>
<img style="width:400px" src="
" alt="">
</figure>
The target RNA was isolated from an overnight culture of E. coli DH5α with pSB1K3_RFP, purified with the RNA isolation kit from ZYMO Research. The activity of the Cas protein was determined using our <a href="https://2019.igem.org/wiki/images/b/b2/T--Bielefeld-CeBiTec--Cas13a_Assay_Protocol.pdf"> Cas13a activity assay protocol</a> based on the RNAse Alert-Kit by Thermo Fischer and evaluated via fluorescent measurement with a plate reader. We tested the Cas with the gRNA and the target RNA as well as the Cas and gRNA without the target RNA, to account for any offsite effects.
Due to the low yield we did not conduct the experiment with Lwa. Lbu has been used in a concentration of 2.3 µM, while the concentration of Lsh was 0.08 µM.<figure > <img style="width:400px" src="" alt="">
<figcaption>In vitro activity of Cas13a Lsh and Cas13a Lbu using the Cas13a activity array based on the RNAse Alert kit (Thermo Fischer). Development of the fluorescence intensity based on the activity of Cas13a Lbu and Lsh over a period of 12 h. For each Cas variant the activity was measured with all essential parts for the activation of Cas13a including the Cas13a protein, gRNA and the target RNA (for Lsh shown in dark purple and Lbu in dark blue) To show any possible offsite events, the activity was also measured without providing of the target RNA (for Lsh pictured in red and Lbu in light blue). </figcaption>
</figure>
We validated the functionality of both Cas13a Lsh and Lbu. Lsh as well as Lbu show an activity. However, Lsh showed a higher activity than Lbu. Furthermore, the negative controls without any target RNA also showed a slight increase of fluorescence intensity. Thereby, the Lbu negative control showed a higher activity than the Lsh control. The activity without the target RNA present can indicate offsite activity but it can also be influenced by airborne RNAse. As both of the received parts are functional, we performed growth experiments with the complete CeDIS system in pRS304 in S. cerevisea INVSc1. Additionally, we also transformed S. cerevisiae with pRS304 Cas13a Lwa to perform growth experiments and test its functionality.
</html>
Proof of concept: Cas13a as a Cell Death inducing system (CeDIS)
In order to test the functionality of our CeDIS system, we conducted growth experiments with INVSc1, S. cerevisiae Yeast Strain containing the system. The strain carries a tryptophan autotrophy. All experiments for the proof of concept were performed with the CeDIS encoded on pRS304. The yeast was grown in liquid SD media without tryptophan, to ensure the selective growth of transformed yeast.
Our initial tests were conducted with yeast, where the cultures had been grown on YPD media. Once an OD of 0.8 had been reached the cells were washed and a medium change was performed. Afterwards the cells were induced by the usage of an YP medium containing galactose as a carbon source. In this initial test Cas13a Lwa and Cas13a Lbu in pRS304 were tested.
During the growth experiments there was no significant difference between the growth of S. cerevisea with and without the Cas13a protein. For both the growth on galactose however is significantly decreased than it is on glucose. After the growth experiment the presence of both variants of Cas13a was verified by colony PCR.
In order to figure out why there was no difference in growth with and without the presence of the Cas13a protein, we tested the Lab application in both glucose containing medium and galactose containing medium, as well as simulated a change of medium similar as performed in the growth experiments. As the Lab application plasmid contains a fluorescent marker, the activation of the GALL promoter was easily detectable via a plate reader.
The results indicate, that there is a slight fluorescence in the presence of glucose (in Fig. 14 shown in red). Especially interesting is the sample with the medium exchange from glucose containing medium to galactose containing medium, as there is no significant increase in fluorescence intensity detectable (Fig. 14 shown in dark purple). The promoter activity is almost completely inhibited in the presence of glucose and does not show any activation 2 h after induction. In galactose however, a clear fluorescence intensity, proving the functionality and its proper induction of the promoter in yeast (Fig. 14 shown in light blue). This is due to the fact, that the GALL promoter is strongly inhibited by glucose and the activation by galactose proceeds slow (Hovlanda et al., 1989). To avoid the slow activation, we tested the use of raffinose in the media for the growth of the cultures and added galactose when higher cell densities were reached to induce the GALL promoter. In comparison to the induction after growth in glucose medium, with the growth on raffinose there is a strong increase of fluorescence intensity when induced afterwards (Fig. 14 shown in dark blue). It is shown, that the cultivate in raffinose instead of glucose is beneficial for the fast and efficient induction of the promoter
According to these results, the cultures were grown in an SD medium with raffinose as sole carbon source and without tryptophan. Even though the inhibition of the GALL promoter with raffinose is weaker than with glucose, the activation by galactose is much faster, which is desirable for our purpose. Furthermore, based on the advice of experts the activation will occur at an OD600 of 0.4.
While yeast containing Cas13a Lwa shows a slight decrease in growth, there is no indication, that the CeDIS is fully activated or functional within the cell. It has previously been reported, that Cas13a Lwa does not produce any unspecific cleavage events in eukaryotes (Cox et al., 2017). Therefore, no unspecific cleavage events occur, making Lwa unfeasible for our system (Wolter & Puchta, 2018). This function is useful when it comes to downregulation of a gene, however it is not feasible for the purpose of a complete knockout or cell death induction. However, for other Cas13a variants collateral cleavage has been described (Abudayyeh et al., 2016).
The results of the cultivation with Cas13a Lbu however shows that the cells reach a premature stationary phase. This indicates, that the growth of the yeast is decreased and indicates collateral cleavage events of the Cas13a. Over the duration of 10 hours there is no significant increase in the OD600 of the induced cells carrying the CeDIS. However, the yeast containing the Cas13a show a significant decrease of growth even with the uninduced cells. The control WT S. cerevisiae also shows a difference in growth on raffinose and galactose. The variation of the OD600 for the Cas carrying yeast can be assigned to the variation in carbon source. While these results show that the CeDIS containing Cas13a is active and effective within yeast, it also indicates that there is a background activity when raffinose is used as an inhibitor of the GALL promoter. Even in the uninduced state, Cas is expressed a on a low level , which leads to a decrease in growth, even if it is less effective than in the induced state.
This can potentially be explained by the structure of raffinose. Raffinose is a trisaccharaide consisting of galactose, glucose and fructose.
The results of the cultivation with Cas13a Lbu however shows that the cells reach a premature stationary phase. This indicates, that the growth of the yeast is decreased and indicates collateral cleavage events of the Cas13a. Over the duration of 10 hours there is no significant increase in the OD600 of the induced cells carrying the CeDIS. However, the yeast containing the Cas13a show a significant decrease of growth even with the uninduced cells. The control WT S. cerevisiae also shows a difference in growth on raffinose and galactose. The variation of the OD600 for the Cas carrying yeast can be assigned to the variation in carbon source. While these results show that the CeDIS containing Cas13a is active and effective within yeast, it also indicates that there is a background activity when raffinose is used as an inhibitor of the GALL promoter. Even in the uninduced state, Cas is expressed a on a low level , which leads to a decrease in growth, even if it is less effective than in the induced state.
This can potentially be explained by the structure of raffinose. Raffinose is a trisaccharaide consisting of galactose, glucose and fructose.
While the galactose, which activates the promoter, is readily accessible due to its position, the inhibitor glucose however is bound by the other two saccharides, galactose and fructose, and might not be fully available for the inhibition of the promoter. This could explain why the difference between induced and uninduced growth is smaller than expected. Furthermore, after transformation the yeast cells have to produce the amino acid tryptophan on their own, as they are grown on a selective medium. This also increases the stress on the cells and could also contribute to the decrease in growth.
According to the previously obtained results we altered our experimental set up. The yeasts are further cultivated on an SD-medium containing raffinose as a sole carbon source, however 4 % (w/v) of galactose added to induce the cells, while the uninduced cultures received 4 % (w/v) of glucose. Thereby we inhibit the GALL promoter in our control samples which will lead to the cells recovering from the previous damage they received by the production of the CeDIS.
The tests have been conducted for both Cas13a Lwa and Cas13a Lsh.
The tests have been conducted for both Cas13a Lwa and Cas13a Lsh.
All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at 30°C and180 rpm. As a control the wild type S. cerevisea was grown on raffinose and at the time of induction was inhibited with 4% glucose (red), as well as treated equal to the cells induced with 2 % galactose (dark purple). S. cerevisea transformed with pRS304_Lsh was cultivated in SD medium with raffinose as sole carbon source and at of the time of induction inhibited by addition of 4% glucose (dark blue). Furthermore, a galactose induced culture containing pRS304_Lsh (light blue) was cultivated.
All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at a temperature of 30 degress celcius at 180 rpm. As a control the wild type S.cerevisea was grown on raffinose and at the point of induction inhibited with 4% glucose(red), as well as treated as if it would be induced with 2% galactose (dark purple). S. cerevisea transformed with pRS304_Lwa was grown on selective SD medium with raffinose as a carbon source, and at point of induction inhibited by addition of 4% glucose (dark blue). Furthermore a galactose induced culture containing pRS304_Lwa (light blue) was measured .
In accordance with the previous experiments,previous experiments, Cas13a Lwa effects a significant reduction in growth, however it does not lead to a premature stationary phase. This confirms the downregulation of RNA rather than an induction of cell death. Even though, this is useful for many applications but not suitable for the design of our CeDIS. Cas13a Lsh however clearly indicates an induction of cell death, when induced with galactose, as a stationary phase with only slight fluctuations after a cultivation time of 10 h. Furthermore, the relative OD600 reached is three times smaller than the OD600 reached by the control group of WT Yeast grown on raffinose with the addition of galactose. The inhibited culture containing Lsh shows a strong reduction of growth rate compared to the control WT cultivation and reaches only 50% of the maximum OD of the control but opposed to the induced sample has a constant growth. This indicates, that the culture was already struggling before the inhibition due to the background activity, but an active inhibition does relieve some of the stress on the culture. It reaches its plateau after 22h which corresponds well with the control grown on both galactose and glucose.
In summary, we showed that CeDIS has the potential to be used as an efficient method to induce the death of a targeted cell. Both Cas13a Lbu and Cas13a Lsh show a high potential to be used in this context and are viable options for the implementation of our CeDIS. However, Lsh showed a higher activity and less off target activation during the in vitro analysis and could be more suitable for the CeDIS.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 572
Illegal BglII site found at 1118
Illegal BglII site found at 1196
Illegal BglII site found at 1883
Illegal BglII site found at 2771
Illegal BglII site found at 3761 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 339
Illegal SapI.rc site found at 664
Illegal SapI.rc site found at 1534
Illegal SapI.rc site found at 2368
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 572
Illegal BglII site found at 1118
Illegal BglII site found at 1196
Illegal BglII site found at 1883
Illegal BglII site found at 2771
Illegal BglII site found at 3761 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 339
Illegal SapI.rc site found at 664
Illegal SapI.rc site found at 1534
Illegal SapI.rc site found at 2368
[edit]
Categories
Parameters
| None |