Composite

Part:BBa_K2942708

Designed by: Yihui Wang   Group: iGEM19_SYSU-Medicine   (2019-10-16)
Revision as of 17:23, 21 October 2019 by Lyt (Talk | contribs)

CMV promoter + Riboswitch + CPG2 + eGFP

Carboxypeptidase is a kind of peptidase that specifically degrades and releases free amino acids from the C end of the peptide chain. And the ligand we use in our project is G2 type which could cleave C-terminal Glu under N-acetyl-L-aspartyl-L-glutamate structure. CPG2 is a zinc-dependent dimeric protein with no mammalian analogue [1], thus in our project we carried out human codon optimization on the original CPG2 and added flag tag for labeling to increase protein expression and make detection easier. CPG2 rapidly hydrolyzes extracellular MTX to its non-toxic metabolites, called 2, 4-diamino-N10-methypteroic acid and glutamic acid [2], so it can be used for the treatment of elevated plasma concentrations of MTX. The principle of this reaction shows in the picture as follows. However, in our experiment we gained the result which is opposite to our expectation. There are several reasons we have considered for this result. For the one hand, we are likely to infer that it is possibly a on-switch. On the other hand, we also consider that maybe the insert of riboswitch has an influence on the expression of its downstream sequence, or there are more segments required for the expression of its downstream sequence. However, one thing we can sure is that the riboswitch did have the control function, and there are still many questions waiting for further exploration. The CMV promoter(BBa_I712004)+ Riboswitches(BBa_K2942701)+CPG2 (BBa_k2942704)+eGFP(BBa_I914891) was linked into the vector pSB1A3 by restriction sites EcoRI and PstI , and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1) and sequencing of the recombinant plasmid (Fig.2).The expression of CPG2 can be indirectly refleted by observing the fluorescence(Fig.3) and directly seen using western blot(Fig.4). Primers for homologous recombination: PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG PSBA3-R CGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGG CMV-F TAAGGATGATTTCTGGAATTCGTGATGCGGTTTTGGCAGT CMVR-RIBO-R CGGTGACAGCTTTGTTTGTTTAGCTCTGCTTATATAAACCTCC RIBOF AAACAAACAAAGCTGTCACCGGATGTGC RIBO-CPG-R GCACAAGGCCGCCAGCTCCATGTTTTTATTTTTCTTTTTGC CPG-F ATGGAGCTGGCGGCCTTGTGCC FLAG-R CTCCTCGCCCTTGCTCACCATCTTATCGTCATCGTCTTTGTA GFPF ATGGTGAGCAAGGGCGAGGAGCTGT GFPR CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for PCR: F TTCGCTAAGGATGATTTCTGGAATTC R CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for sequencing: F TTCGCTAAGGATGATTTCTGGAATTC R CTTGTACAGCTCGTCCATG


Lyt081.png

Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.


Lyt082.png


Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files.


Lyt083.png


Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. We added 4mM theophylline (solved in PBS) into the experimental group according to the Bell’s article [1] while equivoluminal PBS to control group 4h after transfection. the Fluorescence was observed 24h after the transfection.


Lyt084.png


Fig.4 Western blot result. 2×SDS was used to lyse cells when fluorescence 80% of cells can be een with fluorescence.12% SDS-PAGE was used for electrophoresis of denatured protein, and then Millipore Immobilon PVDF membrance (0.45um) was used for following immunoraction(using SIGMA Monoclonal ANTI-FLAG®BioM2−Biotin, Clone M2) and chemiluminescence reaction.

In conclusion, this result well confirmed that nitroreductase transformant certainly turn the prodrug to the effective chemicals.

[1] Bell, C.L., et al., Control of alphavirus-based gene expression using engineered riboswitches. Virology, 2015. 483: p. 302-311.

[edit]
Categories
Parameters
None