Part:BBa_K2936014
cat(encoding catalase)
This is one of catalases from E. coli.
Short description
An enzyme that catalyzes the reduction of hydrogen peroxide.
Description
Catalase is a enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen.
Source
Parageobacillus.
Design consideration
CAT gene encodes catalase in the pathway, which could react with 3, 3’ ,5, 5’ -Tetramethylbenzidine (TMB) to generate blue color.
Mechanism
Gene
ATGGGCATGGCGGACACCAAGAAACTGACCACCAGCTGGGGCGCGCCGGTGGGTGATAACCAGAACAGCATTACCGCGGGTAACCCGGGTCCGACCCTGATCCAAGACGTGCACCTGATTGAGAAACTGGCGCACTTCAACCGTGAACGTGTTCCGGAACGTGTTGTTCATGCGAAGGGTGCGGGTGCGCACGGTTACTTCGAAGTGACCAACGATATGAGCAAATATACCAAGGCGAAAGTGTTTAACGGCGTTGGCAAGCGTACCCCGGTGTTCGTTCGTTTTAGCACCGTTGCGGGTGAACTGGGTAGCGCGGACACCGTGCGTGATCCGCGTGGTTTCGCGGTTAAATTTTACACCGAGGAAGGCAACTATGACATCGTTGGTAACAACACCCCGATCTTCTTTATTCGTGACGCGATCAAGTTCCCGGATTTTATTCACACCCAGAAACGTGACCCGCGTACCCACCTGAAGAACCCGACCGCGATGTGGGATTTCTGGAGCCTGAGCCCGGAAAGCCTGCACCAAGTGACCTACCTGTTTGGCGACCGTGGTATCCCGCTGACCTACCGTCACATGAACGGCTATGGTAGCCACACCTTCAAATGGGTTAACGAAAAGGGCGAGGCGGTGTGGGTTAAGTATCACTTTAAAACCAACCAGGGTGTGAAAAACATGGATCCGGAGCTGGCGGTTAAGATTGCGGGCGAAAACCCGGACTACCACACCGAGGATCTGTATAACGCGATCGAAAAGGGTGACTACCCGAGCTGGACCCTGTATGTGCAAATTATGCCGCTGGAAGATGCGAAGACCTACCGTTTCAACCCGTTTGACGTGACCAAAGTTTGGAGCCACAAGGATTATCCGCTGATCGAAGTGGGCCGTATGGTTCTGAACCGTAACCCGGAAAACTACTTCGCGGAAGTTGAGCAGGCGACCTTTAGCCCGGGTAACCTGGTGCCGGGTGTTGAGCCGAGCCCGGACAAAATGCTGCAAGCGCGTCTGTTCGCGTACGCGGATGCGCACCGTTATCGTGTGGGTGTTAACCACAACCTGCTGCCGATTAACCGTCCGCGTGTTGAGGTGAACAACTACCAGCGTGACGGCTTCATGCGTTTTGATAACAACGGTGGCGGTAGCGTGAACTATGAACCGAACAGCTTCGGCGGTCCGACCGAAGTTAGCGAGCACAAAACCACCCCGTTTCCGGTTAGCGGTATGGCGGAAAGCGTTCCGTACGACGATGACGATCACTATACCCAAGCGGGCGACCTGTACCGTCTGATGAGCGAGGAAGAGAAAGCGCGTCTGGTGAAGAACATCGTTGAGAGCCTGAAGCAGGTGACCAAAGAAGAGATCAAGCTGCGTCAAATTCGTCACTTTTACAAGGCGGACCCGGATTATGGTCGTCGTGTTGCGGAAGGTCTGGGTCTGCAGGTGCCGGACGATGTTATTACCAACGCGTAACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAA
The qualitative experiment
(1) Pick one colony of E. coli harboring Cat genethe into 5 ml LB medium and cultivate it overnight. (2) Measure the Aorbance of the bacteria liquid at the wavelength of 600 nm and dilute the bacteria solution until the OD600 reached 0.5. (3) Make 40 μl diluted bacteria liquid out in 96 - well plates . (4) Add 160 μl TMB reagent in the bacterial liquid containing 96-well plate and incubate it at 37℃ for half an hour. (5) Measure the Aorbance of the reaction solution 96-well plate at the wavelength of 650 nm using ultraviolet spectrophotometer.
Data
Analysis
From the figure 14.1, the color of the third group is enough obvious compared to the background. And at the same time, in order to balance the principle of economy, the ratio of bacterial culture (OD650=0.5) to TMB is designed to be 1:4 .
Results:
The numbers on the photo are the the concentration of catalase ( μl / ml ).
Related conditions
Data
The experimental data was derived from four parallel experiments.
Analysis
From the figure 14.2, the catalytic reaction of CAT with TMB is an obvious color reaction, and the reaction solution appears blue color under natural light. What’s more, it can be seen that as the proportion of catalase getting up, the color of the reaction solution is getting darker and the value of A650 is getting larger. From the figure 14.5, when the ratio of catalase at the range from 2.5E-03 to 3.0E-02 (μl/ml), the concentration of catalase ( μl / ml ) and the value of A650 can be represented by the relation A650=13.872Ccatalase+0.0224. This proves that the CAT gene can be used as an reporter gene for qualitative characterization, as the characteristics they confer on E.coil expressing catalase are easily identified and measured, and they are selectable markers.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 1438
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 1438
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 681
Illegal XhoI site found at 1474 - 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 1438
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 1438
- 1000COMPATIBLE WITH RFC[1000]
None |