Other
Part:BBa_K2560011:Design
Designed by: Tobias Hensel Group: iGEM18_Marburg (2018-08-21)
Phytobrick version of 5'Connector Dummy
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 1
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1
Illegal NotI site found at 7 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1
- 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 1
- 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 1
Illegal XbaI site found at 16 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This connectors were designed to enable flexible cloning of LVL 2 plasmids. For more informations feel free to visit our Design Page.
Source
The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site. Forward Oligo: CTCGCGCTTACTGGAGACGAGCT
Reverse Oligo: CTCAAGCTCGTCTCCAGTAAGCG