Part:BBa_K2571003
FucO L-1,2-propanediol oxidoreductase
L-1,2-propanediol oxidoreductase is an iron-dependent group III dehydrogenase.
FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breaks down and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).
The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to its alcohol derivative (Wang et al. , 2011).
Source:
Gene : FucO
Protein : L-1,2-Propanediol Oxidoreductase
Organism : E.coli K12 (MG 1665)
Our circuit design for FucO gene
Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct is inserted into pSB1C3 and delivered to the Registry.
In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.
FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases go active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010).
In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing for biosynthesis with NADPH (Zheng, 2013).
Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al. , 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al., 2011).
Figure represents the predicted three-dimensional structure of 1,2-propanediol oxidoreductase from E. coli . The protein structure of L-1,2-propanediol oxidoreductase was constructed by using Amber 14. It is demonstrated in the ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure. While constructing, the codon bias rule is obeyed to express the enzyme in Escherichia Coli KO11.
Gel Characterization
FucO composite part is inserted into the pSB1C3 backbone. The construct in pSB1C3 is for submission to the registry and is cultivated in DH5 alpha.
We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, BBa_K2571003, (in pSB1C3) to DH5 alpha; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed our expectations and showed that our parts were correctly inserted and transformed.
FucO and VR primers are as below:
FucO left: GTGATAAGGATGCCGGAGAA
VR: ATTACCGCCTTTGAGTGAGC
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |