Part:BBa_K2629000:Design
The goal of our detector is to reveal the presence of Pseudomonas aeruginosa in a sample thanks to the specific lysis by a bacteriophage. The design of this detector has been inspired by Cork Ireland 2015 team : they created different based on the perfect complementarity of the double strand DNA.
Thus, we - Grenoble team 2018 - decided to create a similar detector for Pseudomonas aeruginosa pathogen.
Contents
A. Bioinformatics Part
A.1 Choice of the target
The detection of bacterial lysis will be done by detecting a gene fragment. Indeed, the gene fragment is intracellular so when detected it implies that lysis occurred.
With this in mind, some reading was done, first, on how to characterize the lysis of Pseudomonas aeruginosa by bacteriophages. At first, we decided to work on virals factors genes. However most of it are find in another strain than Pseudomonas aeruginosa.
Housekeeping genes are genes that are required for the maintenance of basic cellular function. They are normally expressed in all bacterias from one strain. We were looking for genes that would be present in most, perhaps even all Pseudomonas aeruginosa so we choose to focus on this type of genes.
The housekeeping gene used is ProC. Indeed, in 2003, Hakan Savli et al. [3] study “showed that proC and rpoD form the most stable pair in a set of clonally unrelated P. aeruginosa strains with diverse resistance phenotypes.” Moreover, they could conclude that this pair could be used as internal controls in relative comparison studies of resistance genes in P. aeruginosa.
Once the gene is selected, fraction of it were inserted in NebCutter, to get its natural restriction sites. So that we could select several fragments nucleotide (less than 100bp) cut in blunt ends by restriction enzymes.
These fragments are entered in the NCBI database for sequence alignment. By trying several fragments we chose the one that were the most specific to PAO1.
Finally, the target was found in ProC gene (822bp) from PAO1 strain (GenBank : AAG03782.1) located in PA0393 locus. The target is located between nucleotide 766 and nucleotide 802.
A.2 Design of the probe
The probe aims to receive the target, by binding by perfect complementarity. It is made by :
→ Two restrictions enzymes producing cohesives and, SphI and NgoMIV, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. But at the end we use PCR linearization.
→ Twi nicking enzymes, Nt.BspQ1 and Nb.BssS1, enzymes that cut one strand of the double DNA strand. Thereby, the top strand is removed, allowing the binding of the target.
METTRE SHCEMA
Probe :
5’-GCTAGCAGAGCAAGTGCTCTTCACCCTGAACGCCGCCAGCATCGAGAGCAAGTGCCGGCCAGCGCTCCGCCGAGCTGGCATTCAGAGCAAGTGCTAGC- 3’
Design Notes
The probe is designed in order to detect a fragment less than 100 bp. The aim is to create a single strand window that enable the perfect hybridization of our choosen target. It is made by: → Two restrictions enzymes producing cohesives end, SphI and NgoMIV, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. But at the end we trust that using PCR linearization could reduce the background of uncut plasmid. → Twi nicking enzymes, Nt.BspQ1 and Nb.BssS1, enzymes that cut one strand of the double DNA strand.
Source
The aim is to detect a small fragment of Pseudomonas aeruginosa DNA. The target was found in ProC gene (822bp) from PAO1 strain (GenBank : AAG03782.1) located in PA0393 locus. The target is located between nucleotide 766 and nucleotide 802. ProC is an housekeeping gene found in all Pseudomonas aeruginosa strains and not linked in pathogenic behavior of Pseudomonas aeruginosa.