Part:BBa_K2273113

Short version of the Promoter P_penP found in B. subtilis

This Promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. It controls the gene expression of the penP gene that codes for a beta-lactamase found in Bacillus subtilise. Yet there is not much known about the activity and activation of the beta-lactamase PenP in B. subtilis. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. The enzyme PenP harbours a signal peptide sequence and is most likely secreted and localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] To investigate the influence that the presence of the beta-lactamase PenP in B.subtilis has on the sensitivity our biosensor, we analyzed the promoter activity of P_penP under antibiotic stress conditions. We amplified a short and a longer version of this promoter to potentially take into account all regulatory regions upstream of the penP gene.

This part features the RFC10 prefix and suffix:

Prefix with	EcoRI, NotI, XbaI	GAATTCGCGGCCGCTTCTAGA
Suffix with	SpeI, NotI and PstI	ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Beta-Lactam Biosensor

Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.

The role of the beta-lactamase PenP in resistance against beta-lactam antibiotics

In this project we examined the influence of the presence of PenP on our biosensor`s performance. Therefore we investigated the activity of the P_penP promoter in the presence of different beta-lactam antibiotics and two controls (bacitracin and water) in a plate reader assay. The six beta-lactam antibiotics were: ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin and penicillin G. The tested antibiotic concentrations can be taken from Table 1.

**Table 1: Antibiotic concentrations in [µg µl^-1] (final concentration in the well) used in all further plate reader experiments.**

The results from the Plate Reader Assay can be seen in Figure 1.

**Figure 1: Luminescence (RLU/OD₆₀₀) output of the P_penP promoter versions, two hours after beta-lactam induction.** Strains carrying different PenP promoter versions (**long** or **short** / 1 and 2) or with varying genetic backgrounds (either **W168** or **penP::kan^R** / a and b). Mean values and standard deviation are depicted from at least three biological replicates.