Part:BBa_K1949000
cold inducible promoter (Pcold)
This promoter is used to effectively produce proteins at low temperatures. This new promoter, a cold inducible promoter (we call this Pcold) consists of the cspA promoter, Cold Box, 5’-UTR, RBS and DB. The combination (of cspA promoter which is active at both low and high temperature, Cold box which inhibits excessive gene expression, 5’UTR which is stable at only low temperature, and DB which function as an extra RBS) activates gene expression at low temperatures.
Characterization
RFU (Relative Fluorescence Units) of GFP / Turbidity was measured using cells cultured at 18℃ and 37℃ to confirm function of Pcold. The cells harbored a plasmid which carries Pcold-gfp or Ptet-rbs-gfp.
E. coli cells which carry the Ptet-rbs-gfp plasmid was cultured at 18℃, and RFU of GFP was measured at indicated time points. (Fig.1) Also, the same experiment was performed at 37℃. We thought this result was obtained because GFP is easily folded into correct structures at low temperatures. By contrast, RFU of E. coli which harbored Pcold-gfp at 18℃ was about eight fold higher than that at 37℃. From this result, we confirmed Pcold activates gene expression at low temperatures.(Fig.2)
Biobrick Tips
This part is not able to be used for most common assembly, because restriction enzyme digestion with XbaI and SpeI generates an unexpected stop codon. Therefore, this part do not meet the criteria of basic parts construction. Our team generated a unique digestion site, BamHI at the upstream of the suffix. We recommend to use this BamHI site for cloning.
Reference
Famg L,Hou Y and Inoue M.1998. Role of Escherichia coli cspA promoter sequences and adaptation of translational apparatus in the cold shock response. Mol Gen Genet. 1997 Oct;256(3):282-90
Goldenberg D,Azar I,Oppenheim AB,Brandi A,Pon CL,Gualerzi CO. Role of the cold-box region in the 5' untranslated region of the cspA mRNA in its transient expression at low temperature in Escherichia coli. J Bacteriol. 1998 Jan;180(1):90-5.
Nakashima N and Tamura T. 2004. Cell-free protein synthesis using cell extract of Pseudomonas fluorescens and CspA promoter. Biochemical and Biophysical Research Communications 319 (2004) 672
Yamanaka K.1999. Cold Shock Response in Escherichia coli. J. Mol. Microbiol. Biotechnol. (1999) 1(2): 193-202
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 308
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization IONIS_PARIS 2017
Group & Authors: (IONIS_PARIS/La Paillasse, 2017) Summary: We chose to ameliorate its current characterization by measuring the GFP expression level at additional temperatures compared to the existing data obtained by the team (18°C and 37°C).
For the protocol you can see it in our wiki IONIS_PARIS 2017- Laboratory work - Protocols.
Methods: Both GFP constitutive and pCold plasmids were transformed into E.Coli bacteria. These were cultured in liquid medium added with chloramphenicol, and incubated at 37°C for 6 hours. We then transferred them at 27°C and measured the resulting fluorescence every hour for 24h.
<img src=""></img>
We chose 27°C because it was between 18°C and 37°C and could therefore supplement the current characteristic state of the part. What we can see overall is the non-expression of GFP at both 27 and 37°C under the pCOLD promoter (pCOLD-GFP), which is consistent with the construction of this promoter. Indeed, this promoter relies on a cold-inducible system inspired by the cold-shock protein A (cspA). The pCOLD-GFP system permits the transcription of the GFP gene under the form of a cold-inducible RNA thermometer.
We can see that pCOLD-GFP expression does not vary highly with time and remains very low after 25h of incubation. We can however notice that there is still a faint expression of pCOLD-GFP at both 27°C and 37°C. We assume it is normal, because from the total pool of pCOLD-GFP mRNA, a little proportion should still be translated. Indeed, it had been reported that the CspA mRNA was stable 15 minutes at 15°C and 12 seconds at 37°C, and that cold-shock proteins were still translated at high temperatures but in very low amount.
Overall this shows that the system works at these temperatures represses the GFP expression at both 27 and 37°C.
pCold sequenced: Primer suffix: TGAGCCNGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAACAGATAAAANGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTATTATTATTTGTATAGTTCATCNNNGNNATGTGTAATCCCAGCAGCTGTTACAAACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTAACTTTGATTCCATTCTTTTGNTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTATTCCAATTTGTGTCCAAGAATGTTTCCATCTNCTTTAAAATCANTACCTTTTAACTCGATTCTATTAACAAGGGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTANTTCCCGTCATCTTTGAAAAATATAGNTCTTTCCTGTACATAACCTTCNGGCATGNCACTCTTGAAAAAGTCATGNTGTTTCATATGATCTGGGTATCTCGCAAAGCATTGACACCATAACCGAAAGTAGNNACAAGTGTTGGNCCATGGANCAGG
Primer prefix: GGACCGTTTTCCNACCGATTAATCATAAATATGAAAAATAATTGTTGCATCACCCGCCAATGCGTGGCTTAATGCACATCAACGGTTTGACGTACAGACCATTAAAGCAGTGTAGTAAGGCAAGTCCCTTCAAGAGTTATCGTTGATACCCATCGTAGTGCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAAGGTAATACACTATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCCGGATCCATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTNAAAGATGACGGGAACTACNANAC
None |