Part:BBa_K2273115:Design
YhcR cell wall anchor derived from Bacillus subtilis
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 153
Illegal BamHI site found at 168 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 124
Design Notes
The sequence for the cell wall anchor derived from the yhcR gene was amplified from the B. subtilis W168 genome sequence using primers with RFC25 restriction site overhangs to enable translational fusions for localisation studies.
| Prefix with | EcoRI, NotI, XbaI, RBS, spacer sequence, Start Codon and NgoMIV | GAATTCGCGGCCGCTTCTAGAAGGAGGTGTCAAAATGGCCGGC |
| Suffix with | AgeI, Stop Codon, SpeI, NotI and PstI | ACCGGTTAAACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red, AgeI and NgoMIV in orange)
The natural anchor sequence contained a restriction site that was interfering with the RFC25 standard cloning procedure. For that reason, the spacer was modified by PCR mutagenesis. We performed a stepwise PCR with primers that would mutate a single base to keep the correct encoded amino acid information, but to get rid of the restriction site. In the first step, we amplified 2 fragments of the anchor sequence using the following primers:
Fragment 1 Forward Primer containing RFC25 prefix: 5`-gatcGAATTCGCGGCCGCTTCTAGATGGCCGGCTTGGAAGCGACAGTTGAGTACG-3` Revers Primer containing single nucleotide mutation: 5`-GCTGATGAACaGGTGCTGTTC-3`
Fragment 2 Forward Primer containing single nucleotide mutation: 5`-GAACAGCACCtGTTCATCAGC-3` Revers Primer containing RFC25 suffix: 5`-gatcCTGCAGCGGCCGCTACTAGTATTAACCGGTTCACGTTCTGGAGGCGCTCCT-3`
Source
This part sequence was derived from the Bacillus subtilis W168 genome sequence.