Part:BBa_K2254001
No part name specified with partinfo tag.
Usage and Biology
The toehold switch cloning tool is a part used by Hong Kong-CUHK 2017 team for convenient cloning and validation of toehold switch that detect specific sequence of RNA. After designing toehold switch in silico, user can insert the switch into the part by Eco31I digestion followed by ligation.
To obtain the toehold switch insert, user can mix 2 DNA oligos (about 60nt): one oligo contains forward toehold switch sequence with AGGG at 5’ end, and one oligo contains reverse complement toehold switch sequence with AGTA at 5’ end. To allow convenient screening of correct clone, double digestion by Eco31I will remove the constitutive promoter (J23100), and insertion of switch will block the translation of mRFP, resulting colonies that don’t express mRFP, whereas ligation of single digested plasmid will give red colonies.
The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an Xhoi site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.
The Part
Characterisation
Experimental:
Characterisation
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 39
Illegal NheI site found at 62 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 27
Illegal BsaI.rc site found at 738
Functional Parameters
No part name specified with partinfo tag.
| None |