Part:BBa_K1949060:Design

Design Notes

Native Prhl (BBa_R0071)

tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc

Prhl (BBa_K1949060)

tcctgtgaaatctggcagttaccgttagctttcgaattggctaTaaagtgttc

Materials and Methods

Construction

-Strain

All the plasmids were prepared in XL1-Blue strain.

-Plasmids

I. Improved Prhl by Tokyo_Tech 2014 and rhlR assay

A. Pcon--rbs-rhlR-ssrA(BBa_C0071) (pSB6A1), Prhl(LR)(BBa_K1529310)-rbs-gfp (pSB3K3)

B. Pcon-rbs-rhlR(BBa_C0171) (pSB6A1), Prhl(LR)-rbs-gfp (pSB3K3)

C. Pcon-rbs-rhlR-ssrA (pSB6A1), Prhl(RL)(BBa_K1529300)-rbs-gfp (pSB3K3)

D. Pcon-rbs-rhlR (pSB6A1), Prhl(RL)-rbs-gfp (pSB3K3)

E. Pcon-rbs-rhlR-ssrA (pSB6A1), Pcon--rbs-gfp (pSB3K3) …Positive control

F. pSB6A1, pSB3K3 …Nagative control

II. Improvment the native Prhl

A. Prhl(BBa_R0071)-rbs-gfp (pSB3K3)

B. Pcon-rbs-rhlR-ssrA (pSB6A1), Prhl(D6)(BBa_K1949060)-rbs-gfp (pSB3K3)

C. Pcon-rbs-rhlR-ssrA (pSB6A1), Prhl(H7)-rbs-gfp (pSB3K3)

D. Pcon-rbs-rhlR-ssrA (pSB6A1), Pcon-rbs-gfp (pSB3K3) …Positive control

E. pSB6A1, pSB3K3 …Nagative control

III. Comparison the improved Prhl by Tokyo_Tech 2014 to our original improved Prhl

A. Pcon-rbs-rhlR-ssrA (pSB6A1), Prhl(LR)-rbs-gfp (pSB3K3)

B. Pcon-rbs-rhlR-ssrA (pSB6A1), Prhl(D6)-rbs-gfp (pSB3K3)

C. Pcon-rbs-rhlR-ssrA (pSB6A1), Pcon-rbs-gfp (pSB3K3)…Positive control

D. pSB6A1, pSB3K3…Negative control

-Medium

LB medium AK

LB medium containing ampicillin (50 microg/ mL) and kanamycin (50 microg/ mL)

LB medium K

LB medium containing kanamycin (50 microg/ mL)

Assay protocol

The following experiments is performed at 37℃ unless otherwise stated.

I. Improved Prhl by Tokyo_Tech 2014 and rhlR assay

1) Prepare overnight culture for each sample in 3mL LB medium AK with vigorous shaking.

2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

3) Incubate the fresh cultures for 1 h with vigorous shaking.

4) Add C4 or DMSO to each 500 microL sample at the final concentration 10 microM or 100 microM.

5) Incubate the samples for 4 h with vigorous shaking.

6) Add 100 microL of the samples into each well of a plate reader.

7) Measure the fluorescence intensity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

8) Measure the turbidity at 600 nm.

II. Improvement the native Prhl (BBa_R0071)

1) Introduce a point mutation to -10 region of Prhl (BBa_R0071)-gfp (pSB3K3) by inverse PCR using native Prhl(BBa_R0071)-gfp (pSB3K3) as a template and divergent primers. The sequences of the six forward premiers and of one reverse primer are shown below.

WT 　 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaaaagtgttctactagtagcg-3'

F-Mu1 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggntaaaaagtgttctactagtagcg-3' 

F-Mu2 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggcnaaaaagtgttctactagtagcg-3' 

F-Mu3 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctnaaaagtgttctactagtagcg-3' 

F-Mu4 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctanaaagtgttctactagtagcg-3' 

F-Mu5 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaanaagtgttctactagtagcg-3' 

F-Mu6 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaanagtgttctactagtagcg-3' 

R 5'-aattcgaaagctaacggtaactgcca-3' (5’ phosphorylated)

2) Prepare strains containing the pMu1~6 plasmids containing mutated Prhl-GFP (pSB3K3).

3) Streak the transformants on an agar plate containing kanamycin (50 microg/ mL) and incubate overnight.

4) Pore the LB medium K at the extent of covering the surface of the agar, and collect the colonies with a spreader. Then, incubate them in 5 mL LB medium K for 16 h with vigorous shaking.

5) Extract the plasmid, and introduce Prhl(mut)-gfp (pSB3K3) and Pcon-rhlR-ssrA to XL-1 Blue.

6) Pore 200 microL LB medium AK containing C4 (6 microM) in one well of a 96-well plate and inoculate one colony to the well. Incubate the plate for 16 h.

7) Transfer 100 microL of the culture from the above samples to another plate that is suitable for fluorescence measurement. Measure the GFP fluorescence intensity at 490 nm as an exciting wavelength and 525 nm as an emission wavelength as well as the turbidity at 600 nm.

8) Select mutants that have higher SN ratio than native Prhl (BBa_R0071) and grow them in 3mL LB medium AK overnight with vigorous shaking.

9) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

10) Incubate the fresh cultures for 1 h with vigorous shaking.

11) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.

12) Incubate the samples for 4 h with vigorous shaking.

13) Add 100 microL of the samples into each well of a plate reader.

14) Measure the fluorescence intensity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

15) Measure the turbidity at 600 nm.

III. Comparison the improved Prhl promoter by Tokyo_Tech 2014 to our original improved Prhl promoter

1) Prepare overnight cultures for each sample in 3mL LB medium AK with vigorous shaking.

2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).

3) Incubate the fresh cultures for 1 h with vigorous shaking.

4) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.

5) Incubate the samples for 4 h with vigorous shaking.

6) Add 100 microL of the samples into each well of a plate reader.

7) Measure the fluorescence intensity of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.

8) Measure the turbidity at 600 nm.

Reference

(1) Gerardo Medina et al. (2003) Mechanism of Pseudomonas aeruginosa RhlR Transcriptional Regulation of the rhlAB Promoter. BACTERIOLOGY 185: 5976-5983

(2) John S. Chuang et al. (2009) Simpson’s Paradox in a Synthetic Microbial System. SCIENCE 323: 272-275