![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_K1773003:Design
I-F type CRISPR-Cas Cas3 gene
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2623
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1344
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2307
Illegal AgeI site found at 2680 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
These mutagenic primers were used:
EcoRI mutagenesis : Fw: cgttttcaatggcagaatccggcatttgatttggca Rev: tgccaaatcaaatgccggattctgccattgaaaacg
XbaI Mutagenesis: Fw: cgatcatcattattcttctctggatgctgatgttaatttggg Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
PstI Mutagenesis: Fw: gaagactgaactgcctgcggttaaacaacataaac Rev: gtttatgttgtttaaccgcaggcagttcagtcttc
First multiple mutagenesis attempt was not fully successful, because restriction analysis of mutated plasmids showed, that only two out of three restriction sites were mutated.
Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 2) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.
Source
A.actinomycetemcomitans D7-S