Regulatory
hUPll

Part:BBa_K1722000

Designed by: Yin Xiao   Group: iGEM15_SZU_China   (2015-08-26)
Revision as of 11:06, 3 September 2015 by How (Talk | contribs) (BBa_K1722000 short)

hUPll

hUPll is a bladder tissue-specific promoter .

hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein[1] and the expression of uroplakin II was found to be limited to bladder-derived cells.[2,3] Other members of uroplakins, including uroplakinla(UPla), uroplakinlb(UPlb), and uroplakinlll(UPlll), have also been characterized. Therefore, the promoters that direct the expression of the uroplakins may be useful in constructing tissue-specific vectors for bladder cancer gene therapy. Research shows that most of thecis elements that confer the bladder-specificity and differentiation-dependent expression of the human UPll gene reside in the 2542-bp sequence, and TNF driven by the human UPll(hUPll) promoter is effective in the specific inhibition of bladder cancer growth both in vivo and in vitro. Zhu et al transtected the plasmid phUPll-EGFP containing DNA fragment(hUPll) into bladder cancer(BIU-87), renal carcinoma(GRC-1) and endothelial(EC) cell lines.[4](Fig. 1)

Figure 1. The plasmid phUPII-EGFP containing DNA fragment (hUPII) 2542 bp upstream of the UPII gene was transfected into bladder cancer (BIU-87), renal carcinoma (GRC-1), and endothelial (EC) cell lines. Transient transfection was determined either by confocal microscopy or flow cytometric analysis of GFP expression. (a)The activity of human UPII promoter in BIU-87, GRC-1, and EC cell lines. Positive green signals from UPII were more and stronger in BIU-87 than in EC and GRC-1 cell lines.(b) The GFP activity in BIU-87, GRC-1, and EC was tested by flow cytometry. A positive rate from UPII was higher in BIU-87 than in EC and GRC-1 cell lines. The percentage of GFP-positive cells in BIU-87 cell line, EC cell line, and GRC-1 cell line was 10.1, 1.8, and 0% respectively.[4]

2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized. We tested hUPII promoter in HFC(Human Fiber Epithelial Cells),5637,T24 and Hela cell lines. HFC are normal bladder cells, 5637 and T24 are bladder cancer cells while Hela are cervical cancer cells. Result shows it can confer preferential expression of genes in the bladder urothelium like HFC, 5637 and T24, which indicates hUPll has high efficiency in specifically recognizing bladder cells.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Design Notes

We designed the following primers and amplified hUPII promoter from the vector psi-Check2:

CCGGAATTCATCGGGTGATCAGTACTCC(up) TGCACTGCAGACTAGTACTGAGCTGTGAGGT(down)

By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.


Source

hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector.


References

[1]Wu XR, Lin JH, Walz T, et al. Mammalian uroplakins, a group of highly conserved urothelial differentiation related membrane proteins. J Biol Chem. 1994;269:13716–13724.

[2]Yuasa T, Yoshiki T, Isono T, et al. Expression of transitional cell specific genes uroplakin Ia and II in bladder cancer detection of circulating cancer cells in the peripheral blood of metastatic patients. Int J Urol. 1999;6:286–292.

[3]Moll R, Wu XR, Lin JH, Sun TT. Uroplakins specific membrane proteins of urothelial umbrella cells as histological markers of metastatic transitional cell carcinomas. Am J Pathol. 1995;147:1383–1397.

[4]Zhu H J, Zhang ZQ, Zeng XF, et al. Cloning and analysis of human uroplakin II promoter and its ap plication for gene therapy in bladder cancer[J] Cancer Gene Ther, 2004, 11: 263-272


[edit]
Categories
Parameters
None