Part:BBa_K1722002
hTERT is a tumor specific promoter.
hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI).[1] This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells.
So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
We designed the following primers and amplified hUPII promoter from the vector psi-Check2:
CCGGAATTCATCGGGTGATCAGTACTCC(up) TGCACTGCAGACTAGTACTGAGCTGTGAGGT(down)
By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
Source
hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector.
References
[1]Wu XR, Lin JH, Walz T, et al. Mammalian uroplakins, a group of highly conserved urothelial differentiation related membrane proteins. J Biol Chem. 1994;269:13716–13724.
[2]Yuasa T, Yoshiki T, Isono T, et al. Expression of transitional cell specific genes uroplakin Ia and II in bladder cancer detection of circulating cancer cells in the peripheral blood of metastatic patients. Int J Urol. 1999;6:286–292.
[3]Moll R, Wu XR, Lin JH, Sun TT. Uroplakins specific membrane proteins of urothelial umbrella cells as histological markers of metastatic transitional cell carcinomas. Am J Pathol. 1995;147:1383–1397.
[4]Zhu H J, Zhang ZQ, Zeng XF, et al. Cloning and analysis of human uroplakin II promoter and its ap plication for gene therapy in bladder cancer[J] Cancer Gene Ther, 2004, 11: 263-272
None |