Regulatory
shTERT

Part:BBa_K1722001

Designed by: Fang Shu   Group: iGEM15_SZU_China   (2015-08-28)
Revision as of 11:42, 1 September 2015 by How (Talk | contribs)

shTERT is a cancer cell specific promoter with high efficiency.


Introduction

Telomerase reverse transcriptase(abbreviated to TERT, or hTERT in humans) is a catalytic subunit of the enzyme telomerase, which, together with the telomerase RNA component (TERC), comprises the most important unit of the telomerase complex. The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy. The TERT promoter can specifically identify TERT proteins which are largely produced in human tumor cells, thus being expected to be tumor-specific in human body. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). These mutations differentially enhanced the transcriptional activity of the TERT core promoter.TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. More importantly , we mutate the normal TERTp into a new TERTp with high-efficency of the promotion so as to make our system work efficiently. In the experiment, we change 4 base of the TERTp gene. Eventually, The telomerase reverse transcriptase promoter can specifically promotes with the identification of telomerase reverse transcriptase, which means it can only promote in cancer cells. In our system, we use TERTp to promote only in cancer cells. Together with bladder-specific hUPII promoter we can achieve the precision of system’s work in bladder cancer cells.  In our experiment, we constructed three and two plasmids before and after two times to verify the function using high-efficency TERTp.The TERTp can be used to promote in cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment to other cancer.

Design Notes

We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.


Source

The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.

References

[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG (2003). "[Telomerase: an enzyme with multiple applications in cancer research]". Rev. Invest. Clin. 54 (4): 342–8. PMID 12415959 [2]recurrent tert promoter mutations identified in a large-scale study of multiple tumour types are associated with increased tert expression and telomerase activation.PMID:25843513


[edit]
Categories
Parameters
None