PBAD SPL
Description
This is a page containing a synthetic promoter library (SPL) of pBAD promoters made by [http://2013.igem.org/Team:DTU-Denmark 2013 DTU iGEM team]. The library can be used to make and arabinose inducible system with very low leakiness, or tune the the promoter strength of the system when it's turned on.
A tight inducible system can be a very useful tool to express lethal or growth inhibiting proteins in E.coli. It can also be necessary with a non leaky expression system if you would like to visualize the expression of GFP SF in E.coli (see [http://2013.igem.org/Team:DTU-Denmark/HelloWorld link]).
The library
Here is a complete list of the sequences and their relative leakiness and strength:
| Identifier | Sequencea | Induced Strength | Leakiness | Inducibilityb | ||
|---|---|---|---|---|---|---|
| Col. 2 | CTGACGACGCCCCTCTCCGCCCCTTAAAATGTCCA | 14.2 | 0.203 | 69.9 | ||
| Col. 3 | CTGACGTAATCATACCGCCGAAAGTATTATCATTA | 16.6 | 0.426 | 39 | ||
| Col. 4 | CTGACGCGACAACATTGCGTCCTATAAAATGCCGA | 14.2 | 0.345 | 41 | ||
| Col. 5 | CTGACGGCCCGCCCCCGATGCGCATAAAATACCAA | 17.7 | 0.424 | 41.6 | ||
| Col. 12 | CTGACGCGTATCGCGAGCGGGCGTTATTATACGCA | 13.6 | 0.414 | 32.9 | ||
| Col. 10 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 18 | 0.462 | 38.8 | ||
| Col. 9 | CTGACGCCACCCCCCCCCCCGGCGTATAATTCCCA | 16.1 | 0.530 | 30.4 | ||
| Col. 8 | CTGACGCCCTACCGCTCGCCCCCCTATTATACCCA | 13.4 | 0.211 | 63.4 | ||
| Col. 13 | CTGACGCCCCCCCCGTCCACCCCCTAATATCCCGA | 10.9 | 0.096 | 113.6 | ||
| Col. 15 | CTGACGTGCGCCTGCCGTCCAAAGTAATATCCTTA | 15.5 | 0.235 | 65.8 | ||
| Col. 18 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 19.8 | 0.524 | 37.8 | ||
| Col. 19 | CTGACGCTCGCACCGGCGACCCGATAATATCCATA | 18.0 | 0.315 | 57 | ||
| Col. 31 | CTGACGCCCCCCCTCCCCCGACCTAAAATATCCAG | 3.8 | 0.161 | 23.6 | ||
| Col. 29 | CTGACGCCGCTGCACCCGTCCCCCTATTATAGCAA | 14.8 | 0.301 | 49.2 | ||
| Col. 26 | CTGACGCCGATCCTATCTCCCTATTAAAATTTTTA | 13.8 | 0.292 | 47.2 | ||
| Col. 22 | CTGACGCCCCGAATCAGTAGTATTTATTATCTAGA | 16.8 | 0.466 | 36.1 | ||
| Col. 33 | CTGACGCCAGCTTCCTACTTCAAATATAATCCGTA | 14.4 | 1.01 | 14.3 | ||
| Col. 34 | CTGACGTCCCTCTTCCGCGCCCCCTAAAATACCCA | 12.4 | 0.187 | 65.9 | ||
| Col. 35 | CTGACGCCCAACCCGACACAGCGATATAATAATGA | 18.4 | 0.89 | 20.7 | ||
a The sequence of each pBAD promoter characterized. To use this simply produce a primer with the promoter sequence you wish in a tail. Replace the old promoter in your system e.g. Part:BBa_K808000 with the new and see the chance. For more information go to ([http://2013.igem.org/Team:DTU-Denmark/pBAD_SPL link]).
b Inducibility = Induced Strength divided by leakiness.
Characterization
We did a characterization by running growth experiments in parallel on a BioLector ([http://2013.igem.org/Team:DTU-Denmark/pBAD_SPL see more]). Below diagram sums up our results:
Conclusion
The pBAD SPL contain promoters to the arabinose inducible system that will enable low leakiness but still maintain a reasonable promoter strength when turned on. This verifies that the SPL standard ([http://dspace.mit.edu/handle/1721.1/60080 RFC 63]) also can be used to produce promoters for inducible systems.