Part:BBa_I742123:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQ3c1fb5339addd63c-partinfo-00000000-QINU UNIQ3c1fb5339addd63c-partinfo-00000001-QINU

Cloning FbpA as a Biobrick

The coding sequence alone of the Neisserial FbpA protein was cloned from a plasmid obtained from within the University of Edinburgh. Two forms of the protein were cloned: the full length native coding sequence FbpA1 BBa_K1122702 and the coding sequence less the putative signal peptide FbpA2 BBa_K1122703. In both cases primers were designed such that each sequence was terminated by two consecutive stop codons, and flanked with biobrick enzyme cut sites for insertion into pSB1C3.

Primers

F1: cgcttctagatgaaaacatctatccgatacg

F2: cgcttctagatggacattaccgtgtacaacgg

R1: atcctgcagcggccgctactagtattattatttcataccggcttgctc

Native coding sequence used as PCR template indicating primer binding sites:

atgaaaacatctatccgatacgcactgcttgccgcagccctgaccgccgccacccccgcg ctggcagacattaccgtgtacaacggccaacacaaagaagcggcacaagccgttgcagat gcctttacccgggctaccggcatcaaagtcaaactcaacagtgccaaaggcgaccagctt gccggccaaatcaaagaagaaggcagccgaagccccgccgacgtattctattccgaacaa atcccggcactcgccaccctttccgcagccaacctcctagagcccctgcccgcctccacc atcaacgaaacacgcggcaaaggcgtgccggttgccgccaaaaaagactgggtggcactg agcggacgttcgcgcgtcgtcgtttacgacacccgcaaactgtctgaaaaagatttggaa aaatccgtcctgaattacgccacgccgaaatggaaaaaccgcatcggttacgtccccact tccggcgcgttcttggaacagattgtcgccatcgtcaaactgaaaggcgaagcggccgca ttgaaatggctcaaaggcctgaaagaatacggcaagccttacgctaaaaactccgtcgcc cttcaagcggttgaaaacggcgaaatcgatgccgccctcatcaacaactactactggcac gctttcgcgcgtgaaaaaggcgtacaaaatgtccacacccgcctgaatttcgtccgccac agagatcccggcgcactcgttacctattccggcgcagccgtgttaaaatcctcccaaaac aaggatgaggcgaaaaaattcgtcgccttcctcgccggcaaggaaggacagcgcgccctg accgccgtccgtgccgaatatcctttgaatccgcacgtggtatccaccttcaatttggaa cccatcgccaagttggaagcaccccaagtgtccgccaccactgtttccgaaaaagaacac gccacccggctgcttgagcaagccggtatgaaataa

Cloning

Expected PCR fragment sizes: FbpA1, Full length coding sequence 1032bp; FbpA2 Coding sequence less putative signal peptide 969bp. See figure 1.

300px

Figure 1. A 0.8% agarose gel: 1Kb ladder*; FbpA1 native sequence PCR product (plus minor product); FbpA2 less signal peptide PCR product.

The two PCR products were double digested with Xba1 and Pst1, and ligated into pSB1C3 digested with the same enzymes. The ligation mixture was transformed into E. coli JM109, and plasmid DNA minipreps were done on transformant colonies. Aliquots of these minipreps were linearised by digested EcoR1 and run on a 0.8% agarose gel. See figure 2. One miniprep of each coding sequence was then double digested with EcoR1 and PstI, in order to confirm a size difference between the two biobricks of the two coding sequence. See figure 3. In each of the gels the size represented by the bands was as expected.

400px

Figure 2. EcoR1 single digests of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA1 colony 2; FbpA1 colony 3; FbpA2 colony 1; FbpA colony 2; --; --; 1Kb ladder*.

100px

Figure 3. EcoR1 PstI double digest of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA2 colony 2. Plasmid DNA of each sequence (FbpA1 colony 1 BBa_K1122702 and FbpA2 colony 2 BBa_K1122703) was sent for sequencing and submitted to the parts registry.

BBa_I742123 derekju -MIT iGEM 2008

We worked extensively with BBaI742103 and BBaI742123 trying to transform it into Lactobacillus delbruckii subsp. bulgaricus, Lactobacillus delbruckii subsp. lactis, and Lactobacillus acidophilus. The DNA from the 2008 registry failed to transform and Dr. French, who entered this part, was kind enough to supply us with the plasmids. It turned out the registry wasn't able to transform this plasmid into E. Coli, probably due to non-typical growth conditions. Instructions to transform into E. Coli: Transform using normal competent E. Coli procedures (electroporation works too, we actually had better results with electrotransforming) Select with chloramphenicol at 15 mg/l Allow cells to grow for at least TWO DAYS, they take a while to grow and have a low transformation efficiency There may high background growth, (probably due to the relatively low antibiotic concentration and length of the incubation), make sure to verify that you have miniprepped the actual pTG plasmid. Since this is the plasmid with RFP dropped in, you can simply choose the red colonies on the plate. Our project aimed to transform Lactobacillus, a lactic acid bacteria. pTG262 is reported to be able to replicate in Lactobacillus. However, we tried to electroporate pTG262 into Lactobacillus, and unfortunately we were unsuccessful. According to the papers we read and our own experience, the most successful way to transform Lactobacillus, or similar lactic acid, gram-positive bacteria is via electroporation. We tried various protocols obtained from papers (all of which reported Lactobacillus having a very limited range of transformable plasmids, due to possible DNA restriction). To view the methods and protocols we used to try to transform Lactobacillus, please visit the MIT 2008 iGEM team wiki. In conclusion, we were unable to transform plasmid pTG262 into Lactobacillus, and are reasonably confident, that pTG262 CANNOT be electrotransformed into Lactobacillus. Although there are other avenues to possibly introduce foreign DNA into Lactobacillus, electrotransforming with plasmids remains the easiest way. FOr those looking to transform Lactobacillus, other plasmids (such as pJK650 or pLEM415, both of which will be supplied to the registry) should be considered.

;

No review score entered. alex273, Lyon-INSA 2012

We found an additional PstI site, which prevented us from doing any cloning in this vector. As, to our knowledge, this was the only available and working shuttle vector for B.subtilis and E.coli, we built our own plasmid, with a low-copy (K802003) or high-copy (K802004) version. These new plasmids were successfully transformed in B.subtilis and E.coli, no other organism was tested. A full characterization is available on their main pages, including antibiotic resistance thresholds and transformation efficiencies.

;