Part:BBa_K1111012:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1111012

This part can be used in any experience with biotin. Biotinylation of biological material is widely used and quick to do. Once biotinylated, the molecule will be able to attach to the streptavidin expressed in bacteria. For us, the material was nanoparticles, that we nicely biotinylated ([http://2013.igem.org/Team:EPF_Lausanne/Nanoparticles nanoparticles protocol and usage])

Sequencing

We sequenced this part once the Gibson assembly made. To do so, we used primers for iGEM sites VF2 and VR, in order to sequence all that was inserted in the backbone pSB1C3. The sequencing results were aligned to the theoretical coding sequences using ClustalW2 program [http://www.ebi.ac.uk/Tools/msa/clustalw2/].
VF2 sequencing results of INP_Streptavidin Alive for two colonies we picked:
File:Team-EPF-Lausanne ClustalW2 VF2 col1&2 ISA.pdf
VR sequencing results of INP_Streptavidin Alive for two colonies we picked:
File:Team-EPF-Lausanne ClustalW2 VR col1&2 ISA.pdf
Note: you can notice that there is no overlap between the two sequencing results but thanks to another forward primer (5'- AATAATATGGCCGACCATTG -3') we designed, we were able to confirm the sequences.

Microscopy

Also, we transformed cells and used them to do microscopy. Two experiments were done, one with a fluorescent antibody against streptavidin and the other one with a fluorescent biotin. We did both in case the antibody would be too big, since biotin is a small molecule best suit to cross glycocalix.

User Reviews

UNIQ1685b142736ff746-partinfo-00000000-QINU UNIQ1685b142736ff746-partinfo-00000001-QINU