![](https://parts.igem.org/images/partbypart/icon_regulatory.png)
Regulatory
Part:BBa_K733001:Design
Designed by: GU, Bida; SUN Fei Group: iGEM12_HKUST-Hong_Kong (2012-09-16)
Design Note
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter.
The sequences of these two primers are: Forward primer: 5’-CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGAT–3’(Prefix not shown) Reverse primer: 5’–CAATATCCCTTTTATCCATAGAAAAATATATCCTAAATATCT–3’ (Suffix not shown)
Source
Not available at this moment.