Coding
Part:BBa_K861100:Experience
Designed by: Xian Xia Group: iGEM12_WHU-China (2012-09-07)
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K861100
As for the genes we clone, there is no difference between E. coli str. K12 MG1655 and more available DH5we purified and amplified these genes from genome of Escherichia coli str. DH5using PCR. The primers contain the standard restriction enzyme cutting sites. The sequences of the primers used are as below. bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
User Reviews
UNIQ6149483152706e34-partinfo-00000000-QINU UNIQ6149483152706e34-partinfo-00000001-QINU