Part:BBa_J45503:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_J45503
User Reviews
UNIQda66f100baae91d1-partinfo-00000000-QINU
No review score entered. Username |
The 2005 UCSF iGEM team remarks, "By far, the best promoter is hybB, which controlls the hydrogenase II operon. It is clearly active at temperatures lower than 30oC and is off at temperatures higher than 30oC." |
•
[http://2011.igem.org/Team:KULeuven K.U.Leuven iGEM 2011 Team] |
Motivation of this Design/Usage - K.U.Leuven 2011 iGEM Team This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the K410000 as a template using the primers below - hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG Characterization by K.U.Leuven 2011 iGEM Team To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes]. We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system. |
[http://2011.igem.org/Team:Groningen 2011 iGEM team Groningen] |
After cloning the construct designed to measure the promoter activity (BBa_K607039), we have encountered problems while trying to activate it. Previous teams claim that the part is functional and it is active in temperatures below 30 degrees. This was not our experience. The construct, despite having proper sequence and being present in the cells during the measurements (done in presence of antibiotic), did not show any activity neither in low temperature nor in anaerobic conditions, which should also activate it ([http://www.ncbi.nlm.nih.gov/pubmed/10537212?dopt=Abstract Richard DJ, 1999]). After obtaining the negative results, we have also tested two another strains: BW25113 and TOP10. In niether of them the promoter was active.
We believe that the problems with the promoter might be a result of a wrong sequence listed in the Parts Registry. [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00289 Ecocyc.org entry] shows that the promoter is much shorter than the version listed in the Parts Registry. Utilizing the proper, shorter sequence might cause that it will be possible to activate the promoter. |
UNIQda66f100baae91d1-partinfo-00000005-QINU