Part:BBa_K639001
relA (ppGpp synthase)
NOTE: This BioBrick has a PstI site in bp 1363, and uses OWW prefix and suffix. ( http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication )
relA codes for ppGpp synthase, which has been shown to be useful for regulating the rrnB P1 promoter, mimicking the stringent response when over expressed [http://www.sciencedirect.com/science/article/pii/0168165695000039 Tedin, K., A. Witte, et al. (1995)]. ppGpp should effectively down-regulate the promoter by affecting the open complex's stability and inhibiting promoter clearance.
RelA is associated with about every one in two hundred ribosomes and it becomes activated when an uncharged transfer RNA (tRNA) molecule enters the A site of the ribosome, due to the shortage of amino acid required by the tRNA.
This biobrick was made from PCR amplification using cromosomal DNA as template and primers containing [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication Openwetware prefix and suffix];
relA.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGTTGCGGTAAGAAGTGCACA
relA.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACTAACTCCCGTGCAACCGACG
The sequence was confirmed by sequencing.
Our project involved using the rrnB P1 promoter as a stress-sensor, where it would stop expressing an inhibitor for a second promoter, thus giving a signal. To show ppGpp's effect directly, we planned to express relA together with an rrnB P1 promoted lacZ. We were not able to show any effect due to cloning problems of the lacZ construct.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 1383
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 1383
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 1383
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 1383
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 1728
None |