Part:BBa_K358019:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K358019
Using this part, we checked the function of SRRz gene.
Experiment1 Characterization of lytic activity with time
To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this protocol, and we got the following data Protocol
- Pour 3mL of supplemented M9 medium to a Falcon tube.
- Pick out a colony on the plate of E.coli and put into the Falcon tube.
- Grow it at 30 degreees for 16h.
- Dilute it 50 folds with the same media and incubate until OD550 is about 0.15.
- Ditribute 3ml of the culture to falcon tubes and add certain amount of IPTG.
- Incubate the cultures at 30 degrees and measure OD550 of them every 30 min.
As this figure shows, when E.coli starts to lyse depends on the strength of induction of IPTG.
When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h. This result suggests the following two facts.,
- To evaluate the lytic activity quantitatively, we must measure OD550 after cell lysis becomes a steady state,
- We can regulate when E.coli are lysed after induction of λ lysis cassette.
Culture condition:
We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.
BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
To avoid the mutation, we finally decided the cultural temperature at 30C.
User Reviews
UNIQ6d9760af6af495bc-partinfo-00000000-QINU UNIQ6d9760af6af495bc-partinfo-00000001-QINU