Part:BBa_K358019:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K358019

Using this part, we checked the function of SRRz gene.

Experiment1 Characterization of lytic activity with time

To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this protocol, we got the following data

As this figure shows, when E.coli starts to lyse depends on the strength of induction of IPTG. When the concentration of IPTG is 1mM, E.coli starts to lyse after 1.5h, in contrast, when it is 0.03mM, E.coli starts to lyse after 6h.

Culture condition:

We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.

BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca

Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca

To avoid the mutation, we finally decided the cultural temperature at 30C.

User Reviews

UNIQ5f45f0669a949a39-partinfo-00000000-QINU UNIQ5f45f0669a949a39-partinfo-00000001-QINU