Coding
mRFP1

Part:BBa_E1010:Experience

Designed by: Drew Endy   Group: Antiquity   (2004-07-28)
Revision as of 03:19, 28 October 2010 by MMBorch (Talk | contribs) (→‎User Reviews)

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

RANDOM SEQUENCE FOUND WITHIN PART

CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)

Applications of BBa_E1010

User Reviews

UNIQ899149d3b9237ed8-partinfo-00000000-QINU

BBa_E1010 3 Not understood DTU_igem_2010

Characterization of RFP BBa_E1010 We have characterized RFP BBa_E1010 in two different chassis to test the compatibility and the possible range of expressions before limitations in the cell metabolism.

Method We have made constructs with a synthetic promoter library (SPL) in front of the E1010, by using BBa_I03507 and the psB3T5. For information on design of an SPL compatible with the BB standard see [http://bbf.openwetware.org/RFC.html#BBF_RFC_63:_DTU_Synthetic_Promoter_Library_Standard BBF RFC63]. We have benchmarked the relative promoter strength range achieved from the SPL to the standard promoter BBa_J23101, by calculating the relative promoter strength in vivo as suggested in [http://bbf.openwetware.org/RFC.html#BBF_RFC_19:_Measuring_the_Activity_of_BioBrick.E2.84.A2_Promoters_Using_an_In_Vivo_Reference_Standard BBF RFC 19]. For further explanation on methods see our [http://2010.igem.org/Team:DTU-Denmark iGEM_DTU_2010 wiki].

Results We show that the RFP E1010 can be expressed with the following results: 

* In XL1blue with an RPU range form 0 to at least 1,13 RPU.
* In DHA5&alpha with an RPU range from 0 to 1,35 RPU.
Graph2 XL1BLUE.png
Graph3 XL1BLUE.png
Graph4 DH5a.png
Graph5 DH5a.png

Conclusions and Discussion

;

Antiquity

This review comes from the old result system and indicates that this part did not work in some test.

No review score entered. Nkessler

We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004.

UNIQ899149d3b9237ed8-partinfo-00000006-QINU