Composite

Part:BBa_K358019:Experience

Designed by: Ken Kajita   Group: iGEM10_Kyoto   (2010-10-19)
Revision as of 22:21, 19 October 2010 by V08ken (Talk | contribs) (Applications of BBa_K358019)

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K358019

Using this part, we checked the function of SRRz gene.

Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX. It is necessary to repress the lactose promoter and avoid the disadvantage of cell lysis.

Secondly, we cultured samples on M9-Km 30C/overnight.


Experiment 1:

Then, diluted the sample and added IPTG as the inducer. We measured A550 at each time.


Experiment 2:

We added IPTG, not dilute the sample. We measured A550 at each time.


Finally,


Culture condition:

We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.


BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca

Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca

To avoid the mutation, we finally decided the cultural temperature at 30C.

User Reviews

UNIQc3ecf3d9153e043f-partinfo-00000000-QINU UNIQc3ecf3d9153e043f-partinfo-00000001-QINU