Part:BBa_K5317008
MREwt promoter-EGFP
Usage and Biology
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
The varying Metal Responsive Elements (MREs) upstream of the eukaryotic metallothionein (MT) gene were discovered in the early 80s (Carter et al., 1984; Stuart et al., 1985). All MREs a-d carry core consensus sites (TGCRCNC) to which the primary MRE-binding transcription factor MTF-1 can bind after binding to heavy metal ions and translocating into the nucleus (Wang et al., 2004). Physiologically, this leads to the expression of metallothionein, a protein capable of binding metals such as zinc, cadmium, copper and others for metal homeostasis and detoxification (Cousins 1983). The arrangement of the MREs in our promoter construct was inspired by publications from Glanville et al. (1981) and Searle et al. (1985), maintaining the order of MREs from the physiological murine MT promoter.
Cloning
Theoretical Part Design
Placing the MRE containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Cloning
The promoter was synthesized, amplified by PCR with the primers listed in table 1, and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette.
| Primer name | Sequence |
|---|---|
| MREwt_fw | CCGCCATGCATTAGTTATGCACACTGGCGCT |
| MREwt_rev | TGGCGACCGGTAGCGGACGCTTAGAGGACAGC |
Figure 1: The vector map of the assembled construct of MREwt inserted into the EGFP-C2 backbone.
Characterization
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
Single-transfection experiments
Figure 2: With the MREwt-EGFP-C2 single-transfected HEK293T cells showed no EGFP signal under unstimulated conditions. Scale bar = 20 µm.
The single transfection with the MREwt-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.
Co-transfection experiments with MTF-1
To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to second induced plasmid, carrying the MREwt promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double transfection of as many cells as possible, in addition to the non- or only MREwt-EGFP- or only MTF1-mRuby2- transfected cells, is crucial for sensor functionality. Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signalling intracellularly. The mRuby2 signal, which reflects the localisation of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 toghether with the MREwt-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center) and an overlay of the channels (right). Scale bar = 20 µm.
A basal expression of the promoter-driven reporter fluorophore EGFP can be seen for without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.
CuSO4 stimulation
With MREwt-EGFP-C2 and MTF1-mRuby2-C2 double transfected HEK293T cells were exposed to 500 µM CuSO4 for four hours in order to test the responsiveness of the sensor to metal ions.
The representative cells in figure 4 again showed a nuclear-localised MTF1-mRuby2 signal and a nucleocytoplasmic EGFP signal, both with and without copper sulfate stimulation.
Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2 and the MREwt-EGFP-C2 plasmid before (left column) and after (right column) stimulation with 500 µM CuSO4 for four hours. Scale bar = 20 µm.
Unfortunately, no clear visual increase in fluorescence was detected for these promoters compared to the baseline signal. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments. Visual assessment of fluorescence changes is challenging, which is why flow cell cytometry was subsequently considered to obtain a quantitative analysis.
FACS analysis
FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-expressing cells in MTF1-mRuby2-C2 and MREwt-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 5.
Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREwt promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated on the basis of their mRuby2-positivity. n=1.
Considering that the experiment was only conducted once, it is evident that no significant increase of the EGFP-positive cells was associated with an increase in the copper sulfate concentration. The MREwt promoter might not be sensitive enough towards the here used copper sulfate concentrations or an increase in activity is overshadowed by the already high basal activity.
References
Carter, A. D., Felber, B. K., Walling, M. J., Jubier, M. F., Schmidt, C. J., & Hamer, D. H. (1984). Duplicated heavy metal control sequences of the mouse metallothionein-I gene. Proceedings of the National Academy of Sciences of the United States of America, 81(23), 7392–7396. https://doi.org/10.1073/pnas.81.23.7392
Cousins R. J. (1983). Metallothionein--aspects related to copper and zinc metabolism. Journal of inherited metabolic disease, 6 Suppl 1, 15–21. https://doi.org/10.1007/BF01811318
Glanville, N., Durnam, D. M., & Palmiter, R. D. (1981). Structure of mouse metallothionein-I gene and its mRNA. Nature, 292(5820), 267–269. https://doi.org/10.1038/292267a0
Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985
Stuart, G. W., Searle, P. F., & Palmiter, R. D. (1985). Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature, 317(6040), 828–831. https://doi.org/10.1038/317828a0#
Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077
| None |