Part:BBa_K5317010

4xMREd-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

In order to develop a cell-based heavy metal sensor, our research group generated a series of synthetic MTF-1-responsive promoter constructs and evaluated their efficacy. Since Wang and colleagues (2004) suggested a high affinity of MTF-1 towards MREd we synthesized a promoter sequence containing four MREd elements at the positioning of the MREs of the MREwt promoter (K5317003) to exclude possible disruption of the MTF-1 and MRE interaction.

Cloning

Theoretical Part Design

Placing the 4xMREd-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Cloning

The cassette composed of 4xMREd-EGFP was assembled by amplifying the 4xMREd (K5317005) promoter using the primers in table 1 and assembling the promoter in the AseI- and NheI-digested EGFP-C2 backbone (K3338020) using the NEB Hifi Assembly Kit.

Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name	Sequence
4xMREd_fw	CCGCCATGCATTAGTTATGCACACTGGCGCT
4xMREd_rev	TGGCGACCGGTAGCGGACGCTTAGAGGACAGC

The vector map of the assembled construct is shown in figure 1.

Figure 1: Vector map of the assembled plasmid 4xMREd-EGFP-C2 integrating the 4xMREd promoter upstream of the reporter gene EGFP in the pEGFP-C2 backbone.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: Transfection of HEK293T cells with the 4xMREd-EGFP-C2 plasmid showed no base signal of the promoter without metal ion stimulation. Scale bar = 20 µm.

The single transfection with the 4xMREd-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.

Co-transfection experiments with MTF-1

To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to second induced plasmid, carrying the 4xMREd promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only 4xMREd-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality.

Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 toghether with the 4xMREd-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed . Shown are brightfield channels (left), fluorescence channels (images in the center) and an overlay of the channels (right).

A basal expression of the promoter-driven reporter fluorophore EGFP can be seen for without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.

FACS analysis

FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-positive cells of MTF1-mRuby2-C2 and 4xMREd-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 4.

Figure 4: Quantitive validation by flow cytometry analysis. The percentage of HEK293T cells expressing the fluorophore EGFP under the control of the 4xMREd promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated on the basis of their mRuby2-positivity. n=1.

Considering that the experiment was only conducted once, it is evident that no significant increase, even a decrease, of the EGFP-positive cells was associated with an increase in the copper sulfate concentration.

Reference

Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077