Part:BBa_K5399007

pAtU6-sgRNA-SBEI-3xFLAG-SV40 NLS-cas9-NLS-pAtU6-sgRNA-SBEII

This component includes pAtU6, sgRNA-SBEI, 3xFLAG, SV40 NLS, Cas9, NLS, and sgRNA-SBEII. The pAtU6 is used to initiate the transcription of sgRNA-SBEI and sgRNA-SBEII; 3xFLAG is used for the detection and purification of the Cas9 protein; SV40 NLS and NLS are used to target the Cas9 protein to the nucleus for the purpose of cleaving the SBEI and SBEII genes.

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal PstI site found at 1640
Illegal PstI site found at 3062
Illegal PstI site found at 3266
Illegal PstI site found at 3296
Illegal PstI site found at 4508
12
INCOMPATIBLE WITH RFC[12]
Illegal PstI site found at 1640
Illegal PstI site found at 3062
Illegal PstI site found at 3266
Illegal PstI site found at 3296
Illegal PstI site found at 4508
21
INCOMPATIBLE WITH RFC[21]
Illegal BglII site found at 1101
23
INCOMPATIBLE WITH RFC[23]
Illegal PstI site found at 1640
Illegal PstI site found at 3062
Illegal PstI site found at 3266
Illegal PstI site found at 3296
Illegal PstI site found at 4508
25
INCOMPATIBLE WITH RFC[25]
Illegal PstI site found at 1640
Illegal PstI site found at 3062
Illegal PstI site found at 3266
Illegal PstI site found at 3296
Illegal PstI site found at 4508
Illegal NgoMIV site found at 1928
Illegal NgoMIV site found at 3032
Illegal NgoMIV site found at 3105
Illegal NgoMIV site found at 3590
Illegal NgoMIV site found at 4499
Illegal NgoMIV site found at 4968
Illegal NgoMIV site found at 4987
1000
COMPATIBLE WITH RFC[1000]

a. Vector design and construct

We designed two pairs of sgRNA sequences targeting the knockout of the SBEI and SBEII genes using online sgRNA design tools. To prepare the sgRNAs, we first denatured the secondary structures of the complementary oligonucleotide strands by heating them, then gradually cooled the strands to allow annealing and formation of double-stranded sgRNAs under T4 Polynucleotide Kinase (New England Biolabs, UK). The vector psgR-Cas9-At was linearized using BbsI (FastDigest, Thermo Fisher, Waltham, MA, USA). The double-stranded sgRNAs were then ligated to the linearized vector using Quick T4 DNA ligase (New England Biolabs, UK) (Figure 1). The recombinant vectors psgR-Cas9-IbSBEI-sgRNA and psgR-Cas9-IbSBEII-sgRNA were subsequently transformed into E. coli (Figure 2a-2d).

Figure 1. Plasmid map. Left: plasmid map of psgR-Cas9-IbSBEI-sgRNA. Right: plasmid map of psgR-Cas9-IbSBEII-sgRNA.

Figure 2. Construction of original plasmid. a. E. coli with psgR-Cas9-IbSBEI-sgRNA; b. PCR product of IbSBEI-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-CTCCCGATAGGTGATACCTG-3’); c. E. coli with psgR-Cas9-IbSBEII-sgRNA; d. PCR product of IbSBEII-sgRNA (primer F: 5’-TGTAAAACGACGGCCAGT-3’; primer R: 5’-TGGAGAGCTTTTGAGATTCA-3’).

To enhance gene editing efficiency, we integrated the SBEI-sgRNA and SBEII-sgRNA into a single plasmid. The pAtU6-sgRNA-SBEII module was amplified using primers containing 5'-KpnI and 3'-EcoRI sites:

AtU6-F-KpnI: 5’-GTGGTACCCATTCGGAGTTTTTGTATCTTGTTTC-3’

chim-R-EcoRI: 5’-ACGAATTCGCCATTTGTCTGCAGAATTGGC-3’

The vector psgR-Cas9-IbSBEII-sgRNA served as the template. The amplified fragment was inserted into the KpnI and EcoRI sites of the psgR-Cas9-At vector containing the SBEI oligos to create a construct with both customized sgRNAs and a Cas9 module. This construct (psgR-pAtU6-sgRNA SBEI-pAtUBQ-Cas9-tUBQ-pAtU6-sgRNA SBEII) was further digested with EcoRI and HindIII and ligated into the pCAMBIA1300 binary vector for plant transformation.

The final construct, pCAMBIA1300-IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA, was chemically transformed into E. coli. Colony PCR was performed to confirm that the recombinant bacteria contained both the SBEI-sgRNA and SBEII-sgRNA sequences (Figure 3a-3c).

Figure 3. Construction of pCAMBIA1300-IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA (BBa_K5399007). a. E. coli with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA; b. PCR product of IbSBEI-sgRNA/ IbSBEII-sgRNA (primer as former description respectively)；c. Schematic diagram of the final vector pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA (BBa_K5399007) construction.

b. Construction of Cas-SBE strain

To verify that the correct plasmid, pCAMBIA1300-IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA, was transformed into Agrobacterium tumefaciens, we used PCR to identify positive clones (Figure 4a, 4b). Agrobacterium-mediated transformation is widely employed due to its efficiency in transforming a wide range of plant species and producing stable transgenic lines.

Prior to transforming sweet potatoes, we spent over a month inducing callus tissues from the sweet potato plants (Figure 4c, 4d). After infecting the callus tissues with Agrobacterium, we conducted selection on media containing hygromycin to isolate the successfully transformed sweet potato tissues (Figure 4e).

Figure 4. Agrobacterium-mediated infection of sweet potato callus tissues. a. Agrobacterium tumefaciens with pCAMBIA-1300--IbSBEI-sgRNA-Cas9-IbSBEII-sgRNA (BBa_K5399007); b. PCR products of bacterial colonies with IbSBEI-sgRNA/ IbSBEII-sgRNA; c. Callus liquid culture; d. Callus tissues infected by Agrobacterium, co-culture; e. Callus tissues infected by Agrobacterium were selected using hygromycin.

c. Cultivation and genotyping of genetically edited Cas-SBE strain

After multiple rounds of selection, regeneration, and sub-culturing of transgenic sweet potato calli, we performed genotyping of the genetically edited plants. We extracted genomic DNA from the tissue culture seedlings and used it as a template to amplify the hygromycin resistance gene (1026 bp) and the Cas9 gene (4101 bp). We used the hyp gene and the Cas9 gene itself as positive controls and wild type (WT) plants as negative controls. Figures 5b and 5c show that Cas-SBE-1, Cas-SBE-2, and Cas-SBE-3 are positive for transgenic insertion.

Further, we extracted total RNA from the positive transgenic seedlings and performed reverse transcription to convert it into cDNA. This cDNA was then used as a template for PCR. During the PCR amplification, fluorescent dyes on the probes bind to the template DNA and emit fluorescence. The intensity of the fluorescence signals is proportional to the amount of DNA amplified. The PCR instrument monitors these fluorescence signals in real time to quantify the transcription levels of SBEI and SBEII.

In Cas-SBE-1, the expression levels of SBEI and SBEII were reduced by 75%. In Cas-SBE-2, the transcription levels of SBEI decreased by 78% and SBEII decreased by 86% (Figure 5d). Therefore, the knockout of the SBE genes has been successful.

Figure 5. Genotyping of Cas-SBE strain. a. Genetically edited sweet potato tissue culture seedlings; b. PCR product of Hyg gene (Hyg-F: Atgaaaaagcctgaactcac; Hyg-R：ctatttctttgccctcggac); c. PCR product of Cas9 gene (Cas9-F: GACAAGAAGTACAGCATCGG; Cas9-R: AGCTGAGACAGGTCGATC); d. Analysis of SBEI and SBEII gene expression in genetically edited sweet potatoes.

d. Phenotypic analysis of genetically edited Cas-SBE

To ensure that the knockout of the SBEI and SBEII genes does not adversely affect the normal growth of sweet potatoes and thus avoid a significant reduction in yield, we measured and analyzed several developmental traits of the sweet potato plants in comparison with the WT. Internode length is defined as the distance between two adjacent leaves along the stem or branch, specifically the portion of the stem between two nodes. In the transgenic plants, the internode length was reduced by 4.5-4.7 cm compared to the WT, while the stem diameter increased by 1.4-1.8 mm, indicating that the growth rate of Cas-SBE plants is relatively slower and they are more robust (Figures 6a-6c). From a commercial development perspective, these factors should be considered in cost calculations.

Figure 6. Phenotypic analysis of genetically edited Cas-SBE. a. Comparison of potted seedlings between genetically edited sweet potatoes and the WT; b. Comparison of internode length; c. Comparison of stem diameter.

e. Analysis of starch composition in the Cas-SBE strains

We tested the total starch content in WT and genetically edited sweet potato lines (CAS-SBE-1, CAS-SBE-2, CAS-SBE-3) by Total Starch Content (Enzymatic Method) Assay Kit. The results indicate a slight increase in starch content in the CAS-SBE lines compared to the WT; however, the overall difference is not substantial. All three CAS-SBE lines remains relatively similar, with values hovering around 450-500 mg/g dry weight (DW), while the WT shows a slightly lower content (each of the CAS-SBE lines represents an independent biological replicate) (Figure 7). These findings suggest that knocking out the SBE genes does not lead to a marked change in total starch accumulation in sweet potato plants.

In cases where there is no significant difference in total starch content, we have measured the percentage of amylose in both Cas-SBE and WT. Most plants naturally store starch as a mixture of amylose and amylopectin, with amylopectin making up most of the starch granules. Starch granules composed entirely or almost entirely of amylose do not exist in nature because excessively high levels of amylose can adversely affect the overall health and productivity of plants. However, it is feasible to increase the amylose content to a reasonable extent. In our gene-edited Cas-SBE plants, the proportion of amylose increased from 21% to approximately 40%, representing an overall increase of 80%-104% (Figure 8). These results indicated that the effectiveness of our SBE gene knockout.

Amylose mainly belongs to RS2 and RS3 resistant starch, which has the property that resistant starch is not easily digested and degraded by amylase. Therefore, based on the increase in amylose content, we would also expect an increase in the resistant starch content in the Cas-SBE plants. We used a resistant starch assay kit to measure the resistant starch content in the plants. Compared to the WT plants, the resistant starch content in the Cas-SBE plants increased by 121%-133% (Figure 9). Foods with high resistant starch content can provide anti-glycemic effects.

Figure 9. Percent of resistant starch content.

We have demonstrated that the BBa_K5399007 can knock out the SBEI and SBEII genes in sweet potatoes and significantly increases the amylose content without causing severe impacts on plant growth and development.