Part:BBa_K4491007

pBAD_AP

pBAD
Function	Inducible promoter
Use in	Bacterial
Chassis Tested	Escherichia coli
Assembly Used	JUMP Assembly
Abstraction Hierarchy	Part
Related Device	BBa_K2442101
Backbone	pSC101
Submitted by	Cambridge iGEM 2022

This gene encodes an improved version of the wild-type araBAD promoter (nicknamed pBAD), an inducible promoter controlled by araC protein. The native pBAD is part of the araBAD operon, which is responsible for regulating arabinose metabolism in E.coli.

Usage and Biology

The exact definition of the araBAD promoter varies ambiguously between sources. Historically, pBAD only refers to a short segment upstream of the +1 transcription start site (referred to as the core promoter), containing the -35 and -10 boxes. However, as a complete promoter Part, the regulatory region further upstream is also included. In the following discussion, our definition of pBAD refers to the whole sequence consisting of both the regulatory sequence and the core promoter.

Figure 1: Schematic diagram of the araBAD operon and its upstream regulatory region.

The araBAD promoter regulates the araBAD operon and is controlled by araC - a regulatory protein known for its “love-hate” mechanism of action. The upstream regulatory region consists of various protein binding sites - araI1, araI2, araO1 and araO2 can be occupied by araC. Between araI1 and araO1 also lies a CAP binding site, which recruits Catabolite receptor protein for transcription activation. The spacing between araO1 and O2 is noticeably large, reaching nearly 210 bp, which, unsurprisingly, is responsible for the overall bulkiness of the promoter. Interestingly, a region within this spacer contains a promoter of araC gene, which runs in the opposite direction to the araBAD operon. This promoter is regulated by araO1 just downstream. The araC protein therefore not only regulates the araBAD operon but also controls its own production by binding to araO1 region (negative autoregulation).

In the absence of L-arabinose, transcription is repressed by the action of two araC molecules binding to the structure. One araC binds to araI1 and the other binds to araO2 further upstream. The dimerization domain confers high affinity, bringing the two protein molecules closer to dimerize, essentially creating a DNA loop as a result. This looping mechanism prevents any sigma factors, RNA Polymerase or CRP from being recruited, thus repressing transcription.

In the presence of L-arabinose, binding of the sugar molecule to the arabinose-binding domain triggers a conformational change in the DNA-binding domain of araC, which reduces its affinity to distal araO2 site. This makes the protein more favourable to bind to araI2, just downstream of araI1. Therefore, the dimerized complex is formed at araI1-araI2 site instead of araO2-araI1, which breaks the loop and hence activates transcription. The dimer araC also “nudges” the RNA Polymerase for enhanced transcription.

Figure 2: Schematic diagram of the regulatory mechanism of araBAD operon in the absence (top) or presence (bottom) of arabinose.

pBAD Entries in the Registry

TBA

Preamble from Cambridge team

The Cambridge 2022 Team had intended to use the araBAD promoter to build an antithetic feedback circuit that demonstrates robust perfect adaptation (RPA). However, we were concerned that wild-type PBAD is relatively large, topping at around 300 bp, which increases the bulkiness of our Level-2 construct and reduces efficiency. Also, pBAD, by nature, is a relatively leaky and medium-strength promoter, therefore, lots of araC is needed to fully reach maximal activation. However, overexpression of araC is toxic to cells, and thus can drastically impede performance of the circuit. we therefore thought it would be an interesting Part Improvement project to redesign the existing wild-type promoter. Our initial goal was to engineer a PBAD with minimal length, but shows both lower leakiness and higher maximal activity. To achieve this, we did intensive literature search for prior optimization strategies. To understand the rationales, we also gathered information on the regulatory mechanism of the promoter, which was presumably only prevalent in papers from the 1970s.

To see our design strategies, check out the Design page.

Experimental design

Overview

To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs [], using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below.

Identifier*	Rationale 1**	Rationale 2	Rationale 3	Part sequences
AP1	+	-	-	agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta cctgacgctttttatcgcaactctctactgtttctccatacccg
AP2	+	+	-	agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat cctgacgctttttatcgcaactctctactgtttctccatacccg
AP3	+	-	+	agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggat cctacctgacgctttttatcgcaactctctactgtttctccatacccg
AP4	+	+	+	agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg
AP5	+	+ (78)***	+	agaaaccaattgtccatattgcatcagacattgccgtcacattgattatttgcacggcgtcacactttgctatgccatagcaagatagt ccataagattagcgtttttatcctgacgtgcgcctgccgtccaaagtaatatccttacatacccg
AP6	-	+	-	acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat cctgacgctttttatcgcaactctctactgtttctccatacccg
AP7	-	+	+	acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg
AP8	-	-	+	acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg
AP9	-	-	-	agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta cctgacgctttttatcgcaactctctactgtttctccatacccg