![](https://parts.igem.org/images/partbypart/icon_terminator.png)
Part:BBa_K4260008
Tryptophan, rho-independent terminator
Type: Terminator
Group: iGEM_TecCEM
This part is a 20 bp-long terminator, from the Trp operon, that forms a stem-loop structure. The tryptophan operator provides transcription efficiency as a terminator design, promoting a rho-independent or intrinsic termination. This means that the termination process carried out by Trp terminator does not depend on the presence of termination factors [1]. Moreover, it shares several features with other known sites of transcription termination of E. Coli. The tryptophan terminator was designed with scientific literature and iGEM team's research, in this way it was used for the transcription termination of a gene of another part (to know more, please visit BBa_K4260006), that was tested in E.coli DH5α and BL21 strains with experimental procedures.
Sequence & Features
![](https://static.igem.org/mediawiki/parts/a/a5/K4260008_TecCem_Fig1.png)
Length: 20 bp
Direction: Reverse
Sequence (5’ to 3’): CCCACTCAGTAGTGGGTTTT
The secondary structure prediction was obtained with UNAFold, indicating a ΔG value of -5.20. Other data obtained from the model is shown in the table below.
![]() |
![]() |
||||||||||||||||||||
Tpr terminator. [Obtained with UNAFold]. |
the structure prediction. [Obtained with UNAFold] |
References
[1] Chen, J., Morita, T. & Gottesman, S. (2019). Regulation of Trsncription Termination of Small RNAs and by Smll RNAs: Molecular Mechanisims and Biological Functions. Frontiers in Cellular and Infection Microbiology. https://doi.org/10.3389/fcimb.2019.00201
None |