Software error:
Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 250. Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Status: 500 Content-type: text/html
Software error:
Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 250. Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Status: 500
Content-type: text/html
Software error:
Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 250. Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Design Notes
The Dam methylase was obtained through PCR using BL21 as the genomic DNA template. Primers were designed to include overhangs coding for XbaI and SpeI recognition sites in order to allow the gene to be BioBricked according to the BioBrick Standard. The primers are as follows:
- Forward PCR primer containing XbaI overhang (bold) for BioBricking:
GCTCTAGATGAAGAAAAATCGCGCTTTTTTG
- Reverse PCR primer containing SpeI overhang (bold) for BioBricking:
GGACTAGTATTATTTTTTCGCGGGTGAAAC
BioBrick overhang shown in bold
Source
This is one of three site-specific DNA methylases found in most laboratory strains of E. coli.