Part:BBa_K4197007
Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1
OmpA_ana o 3 fusion to display cashew allergen.
Introduction
This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).
Construction
Ana o 3 gene ordered on IDT (shown above in Figure 12) was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was 479 bp.
Amplification product sizes were checked on EtBr stained agarose gel (Figure 13).
Figure 13: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp. PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).
The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized (see Figure 6) by In-Fusion.
In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 14).
Figure 14: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR. PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).
These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments: 5052 bp and 3211 pb) to assess the assembly (Figure 15).
Figure 15: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV. Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).
The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Ana o 3.
The plasmid was finally used to transform E. coli Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.
Achievements so far: we managed to have all our allergen construction correctly cloned.
Validation
References
More information about the project for which the part was created: DAISY (INSA-UPS 2022)
Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2368
| None |