Part:BBa_K4197006
OmpA_Der p 1 Fusion
Gene fusion to express the dust mite allergen Der p 1 on the surface of E. coli.
Introduction
This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: U11695.1). The mite allergy prevalence is 20% (lieberman and al. 2018) in the US and Der p 1, triggers 87% of the patients with dust mite allergy (Mueller and al. 2015). Ara h 2 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003). Ara h 2 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ara h on the surface of E. coli . This lippoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).
Construction
Der p 1 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Der p 1 (cctgtattttcagagcatgaaaatcgtgctggc). Expected size of the amplicon was 994 bp.
Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 9).
PCR products matched expected sizes and amplicons were further purified from the gel. The Der p 1 construction was inserted into linearized pET-21 b (+)_OmpA (see Figure 6) by In-Fusion.
The In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc; expected size of the amplicons: 1894 bp) (see Primers List). 12 positive transformants were detected (Figure 10).
Four of these transformants (colonies 2, 6, 11 and 13) had their plasmid extracted by Miniprep and digested by SalI (expected size of the fragments: 6 kb and 1 kb) or double-digested by HindIII and EcoRI-HF (expected size of the fragments: 5.5 kb and 1.5 kb) to assess the assembly (Figure 11).
The correct restriction maps were obtained for the clones which were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Der p 1.
The plasmids were finally used to transform E. coli Tuner cells to express the Ompa_Der p 1 construction at the cell membrane.
References
More information about the project for which the part was created: DAISY (INSA-UPS 2022)
Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Fel d 4
- Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680
- Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
- Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 130
Illegal NheI site found at 92
Illegal NotI site found at 1632 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 130
Illegal BamHI site found at 124
Illegal XhoI site found at 1641 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 1000COMPATIBLE WITH RFC[1000]
None |