Regulatory
pLacIQ1
Part:BBa_K091112:Experience
Designed by: Pallavi Penumetcha Group: iGEM08_Davidson-Missouri_Western (2008-06-20)
This part worked as expected in HB101 cells.
Applications of BBa_K091112
User Reviews
The MWSU/Davdison iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
TGTGTGGAATTGTGAGCGGATAACAATTTCACACA
UNIQ9f72f79ed1943d33-partinfo-00000000-QINU UNIQ9f72f79ed1943d33-partinfo-00000001-QINU