Composite

Part:BBa_K2834005

Designed by: Viana Isabel Pérez Domínguez   Group: iGEM18_Tec-Chihuahua   (2018-10-07)
Revision as of 16:45, 17 October 2018 by Viana (Talk | contribs)

Expressible defensin 1 antimicrobial peptide from Apis mellifera


This BioBrickâ„¢ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 1 honey bee antimicrobial peptide, a 6x His-tag, and a T1 terminator from E. coli. This composite enables the expression of defensin 1 in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.


As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 1 and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCAT GGTAACTTGTGACCTTCTCTCATTCAAAGGACAAGTTAATGACAGTGCTTGCGCTGCTAACTGTCTCAGTTTGGGTAAAGCTGGAGGTCATTGCGAGAAAGGAGTTT GTATTTGTCGAAAAACCAGTTTCAAAGATCTCTGGGACAAACGTTTCGGTCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAG TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC


Usage and Biology


Defensin 1 is an antimicrobial peptide of the honeybee. It's a component of their innate immune response, which contains 51 amino acids and 6 cysteine residues forming three disulfide bonds2. It is synthesized in salivary glands and characterizes the social immunity. Sometimes is able to protect honeybees even in early stages and act as part of individual immunity4. This AMP is expressed in the head and thorax of honey bees by the hypopharyngeal, mandibular and thoracic salivary glands3. It is present in the royal jelly, honey and hemolymph. Originally, it was isolated from royal jelly, and therefore named royalisin2.

This peptide is effective against Gram-positive bacteria and some species of Gram-negative bacteria like Pseudomonas aeruginosa and Salmonella choleraesuis1. The mechanism of the defensin effect is reduced to disturbance of integrity and permeability of the cytoplasmic membrane. Defensin 1 is used in our project against Paenibllus larvae and Melissococcus plutonius, this would control the immunity level of a honey bee colony and reduce the using of antibiotics.


Characterization of defensin 1


This composite will be characterized with the intention of expressing defensin 1 in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotic susceptibility testing by measuring OD600 in broth.

BioBrick assembly

To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 415 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2442 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following the antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, the linearized plasmid with one enzyme, and the linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.


900px
File:Def12.png
hfdhdnfdjfdhjrdsjtrshrshessgteagfesgfesgfesgf


Sequence and Features



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 233
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 86
  • 1000
    COMPATIBLE WITH RFC[1000]


References

1. Bucekova, M., Sojka, M., Valachova, I., Martinotti, S., Ranzato, E., Szep, Z., Majtan, V., Klaudiny, J., & Majtan, J. (2017). Bee-derived antibacterial peptide, defensin-1, promotes wound re-epithelialisation in vitro and in vivo. Scientific reports, 7(1), 7340.

2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919

3. Ilyasov, R., Gaifullina, L., Saltykova, E., Poskryakov, A., & Nikolenko, A. (2012). Review of the Expression of Antimicrobial Peptide Defensin in Honey Bees Apis Mellifera L., Journal of Apicultural Science, 56(1), 115-124. doi.org/10.2478/v10289-012-0013-y

4. Tesovnik, T., Cizelj, I., Zorc, M., ÄŒitar, M., BožiÄ, J., Glavan, G., & Narat, M. (2017). Immune related gene expression in worker honey bee (Apis mellifera carnica) pupae exposed to neonicotinoid thiamethoxam and Varroa mites (Varroa destructor). PloS one, 12(10), e0187079.


[edit]
Categories
Parameters
None