Part:BBa_K2668020
Sirius: CBM3a - mRFP1 fusion
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 1272
Illegal AgeI site found at 1384 - 1000COMPATIBLE WITH RFC[1000]
Introduction
Sirius (BBa_K2668020) is a fusion protein between CBM3a and mRFP1. By fusing CBM3a to a fluorescent moiety, this part allowed us to investigate the binding capability of CBM3a to cellulose.
Construction
The Sirius part (BBa_K2668020) correspond to the Cellulose Binding Module Type 3a (CBM3a) fused by its endogenous C terminal linker to a red fluorescent protein mRFP1. The name Sirius was chosen as a reference to the brightest star of the northern hemisphere Alpha canis majoris which is the central star of the great dog constellation. IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned by In-fusion into the pSB1C3 plasmid with the below primers and then transformed into E. coli Dh5-alpha strain. Figure 1 shows the restriction map of the resulting clones.Clones from lane 3 to 8 were ok.
Primer used for cloning in pET28: (From 5' to 3')
- Sirius_pET_Forward: TAAGAAGGAGATATACCATGAATGCTACGCCAACTAAGGGTGC
- Sirius_pET_Reverse: CTCGAGTGCGGCCGCAAGCTTAGCACCGGTGGAGTGACG
Primer used for cloning in pSB1C3: (From 5' to 3')
- Sirius_pSB1C3_Forward: CGCGGCCGCTTCTAGAAATGCTACGCCAACTAAGGGTG
- Sirius_pSB1C3_Reverse: AGCGGCCGCTACTAGTAGCACCGGTGGAGTGACG
Characterization
1. Production of Sirius
The part BBa_K2668020 was cloned into the pET28 expression vector (in phase with the pET28 His Tag) using In-Fusion Cloning Kit. The resulting construct was transformed into E. coli strain BL21 and expression of the recombinant protein was induced using 1 mM IPTG for 4h at 37°C. Cells were lysed by sonication and the His-tagged protein was then purified on IMAC resin charged with cobalt (Sigma). Results are shown on figure 2. A large amount of protein at the expected size for Sirius in the Cell Free Extract (52 kDa, lane CFE) was found predominant. The same band was detected in elution samples (E1/40 and E1/100). The degree of purity of full length Sirius was about 72%. In addition to the full length protein, several extra bands that likely correspond to proteolysis products were observed.
Validation of Sirius
Once produced in E. coli, fixation of Sirius to cellulose was tested using cellulose pull down assays. 70 µM of Sirius protein or mRFP1 (without CBM3a) or buffer were incubated with cellulose (Avicell). After five washes with resuspension buffer (50mM Tris HCl pH 8), cellulose pellets were recovered and the associated fluorescence was measured in plate reader. Results are shown on figure 3. Only the cellulose pellet incubated with Sirius protein displays a high level of fluorescence. Control experiments showed that only background levels of fluorescence are retained in the cellulose pellet incubated with mRFP1 alone (no CBM3a). These results clearly show that CBM3a of Sirius interacts with cellulose, and thus mediates fixation of the mRFP1 protein to cellulose.
Thus, fluorescent cellulose was produced. This results was also confirmed using bacterial cellulose from Gluconobacter hansenii. This cellulose was put in contact with either mRFP1 alone or the Sirius construction (mRFP1-CBM3a). After washing, the cellulose was exposed to UV and a picture was shot (figure 4). Red fluorescence was only observed with Sirius, demonstrating again the strong affinity of the construction for cellulose and the functionality of the CBM3a domain.
| None |