Composite
Toehold S

Part:BBa_K2550000:Experience

Designed by: Janet Standeven, Abby Bell, Megan Hong, Yan Zhang, Courtney Taing, Ashtyn Cauffman   Group: iGEM18_Lambert_GA   (2018-10-08)
Revision as of 14:46, 16 October 2018 by ABell (Talk | contribs) (Applications of BBa_K2550000)

Applications of BBa_K2550000

T--Lambert_GA--Wetlab.png T--Lambert_GA--BBTHJSTrig.jpeg

Figure 1: Toehold structure implemented in the T7 Toehold LacZ biobrick that was developed in the Nupack software which confirmed the shape of the toehold sequence.

The toehold sequence, part BBa_K2550100, is 108 bp long and was obtained from the 144 first generation orthogonal toehold switches collection from the 2017 Collins paper titled Toehold Switches: De-Novo-Designed Regulators of Gene Expression. This distinct riboregulator follows the T7 promoter that is assembled in the T7 Toehold LacZ biobrick. This image above is a visual representation of this unique toehold structure.

T--Lambert_GA--BBTHJSTrig.jpeg

Figure 2: The T7 Toehold LacZ biobrick transformed on a chloramphenicol and xgal plate expressing blue pigment without trigger sequence as a result of the strong T7 promoter (Image on the left). T7 Toehold LacZ and trigger sequence transformed in a dual plasmid transformation on a carbenicillin, chloramphenicol, and xgal plate that is expressing a blue pigment due to presence of trigger sequence (Image on the right).

T7, part BBa_I719005, is a strong constitutive promoter derived from the T7 bacteriophage that expresses proteins in the presence of T7 polymerase. It was observed that the toehold expressed a blue pigment when inoculated into xgal and Luria Broth. Although a lighter shade than when fully induced, we hypothesize that this pigment is due to toehold leakiness as a result of the strength of the T7 promoter.

Sequencing Analysis

TAATACGACTCACTATAGG

Figure 3: Biobricked T7 promoter sequencing results.

GGGAGAGGGTATAAGTAAATCGCTTGCTGTATGTCGTTAAACAGAGGAGATAACGAATGACAGCAAGCAACCTGGCGGCAGCGCAAAAG

Figure 4: Biobricked Toehold sequencing results which was used in the NuPack software to illustrate the functioning Toehold Switch .

ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTT CGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA

Figure 5: Biobricked LacZ gene sequencing results that proved the 1 base pair wobble was successful.

User Reviews

UNIQf25b431c6a718953-partinfo-00000000-QINU


UNIQf25b431c6a718953-partinfo-00000001-QINU