Part:pSB1A2
pSB1A2 (Replaced by pSB1A3)
pSB1A2 is a high copy number plasmid carrying ampicillin resistance. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell).
pSB1A2 has one terminator upstream of its MCS, which is oriented to prevent transcription from *inside* the MCS from reading out into any DNA outside the MCS. The orientation of the pBLA promoter driving the AmpR gene is such that relatively little transcription should be coming into the MCS from upstream. Ideally, a future version of the standard biobrick vectors would have terminators bracketing an MCS that were 100% efficient in terminating both into and out of the MCS region.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 2064 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 2058
Illegal suffix found at 2 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 2058
Plasmid lacks a suffix.
Illegal XbaI site found at 2073
Illegal SpeI site found at 2
Illegal PstI site found at 16 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 1097
sequence between EcoRI and XbaI
The sequence in iGEM database is
GAATTCGCGGCCGCATCTAGA , but isn't it
GAATTCGCGGCCGCTTCTAGA ?
--marion 08:50, 19 June 2008 (UTC)
chassis | |
copies | 100-300 |
insert | None |
mcs | BioBrick |
origin | pMB1 |
resistance | A |