Part:BBa_J23150
1bp mutant from J23107
Group: Munich/Westmeyer lab, 2024 Author: Karl Boegel
Summary: Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself, but instead with overhangs that resembled the split promoters J23150 and J23151 each to facilitate overhang ligation.
J23107 -> J23150 150: tttacggctagctcagtcctaggtattatgctagc 107: tttacggctagctcagccctaggtattatgctagc
J23107 -> J23150p J23150p = 352 % % of J23104 The mutation strongly enhances the promoter’s strength above the previously strongest tested promoter of the family.
J23150p -> J23150 J23150 = 219 % of J23104 Still a major optimization in the promoter activity due to reversal of a point mutation causing an Amino acid change in the coding sequence resulting in mTurquoiseL9F, indicating importance of this protein region.
123107 -> J23150p = 50 % -> 352 % of J23104 J2350p -> J23150 = 352 % -> 219 % of J23104
J23114 -> J23151
151: ttgatggctagctcagtcctaggtacaatgctagc
114: ttgacagctagctcagtcctaggtattgtgctagc
J2351 = 163 % of J23104
drastic improvement shows that the mutation has a profound effect, bringing a weak promoter above the level of the previously strongest tested promoter.
J23114 -> J23151 = 14 % -> 163 % of J23104
//direction/forward
//chassis/prokaryote/ecoli
//promoter
//regulation/constitutive
negative_regulators | |
positive_regulators |