Part:BBa_K2281005
--ScOYE--
Introduction
LOCUS NM_001179310
SIZE 1203 bp
DEFINITION Saccharomyces cerevisiae S288c NADPH dehydrogenase (OYE2).
ScOYE stands for Saccharomyces cerevisiae Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.
胶图
primer: ScOYE-Ecor1-F:CGGAATTCATGCCATTTGTTAAGG
ScOYE1-R-PstI,ACCTTGCCCTTTTTTGCCGGACTTAATTTTTGTCCCAACCG
From the diagram above we can see gene OYE has been ligated to the vector properly.
Source
SOURCE Saccharomyces cerevisiae S288C
Saccharomyces cerevisiae is a species of yeast. It has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums; it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by a division process known as budding
ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces.
References
REFERENCE 1 (bases 1 to 1203)
AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441
REFERENCE 2 (bases 1 to 1203)
AUTHORS Johnston,M., Andrews,S., Brinkman,R., Cooper,J., Ding,H., Dover,J., Du,Z., Favello,A., Fulton,L., Gattung,S. et al. TITLE Complete nucleotide sequence of Saccharomyces cerevisiae chromosome VIII JOURNAL Science 265 (5181), 2077-2082 (1994) PUBMED 8091229
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 646
Illegal BamHI site found at 1017 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 778
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 824
None |