Composite
D22C

Part:BBa_K2342007

Designed by: Meryem Ecem Kaya   Group: iGEM17_Aalto-Helsinki   (2017-10-25)
Revision as of 09:56, 28 October 2017 by Mkaya (Talk | contribs)


DCD1L peptide linked to a CBM with a 22 AA linker

1. Biology

Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD1 and DCD1L. DCD1L is one of the most abundant form of dermcidin derived peptide. DCD1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes. (2,6) Although the precise mode of action is not entirely explored, it is thought that DCD1L hexamers form pores on bacterial membrane leading to cell death. (5) Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) 6xHis tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Employing of Smt3 tag is beneficial in several aspects in our project. Ulp1 enzyme is able to cleavage fusion peptide by recognizing Smt3. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His-Smt3 tag. Smt3 tag Another advantage of using Smt3 is due to its effect on solubility and preventing inclusion bodies of fusion peptide significantly easing purification step. Finally, it facilitated easier detect of the peptide with a conventional method, SDS-PAGE. Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. For further detailed documentation of part usage, function and validation, see following sections below.

Promoter information

The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf )

Figure 1. Plasmid map of our composite part (Geneious version 10.1.3 (http://www.geneious.com, Kearse et al., 2012)) (1)

Sequencing results

Figure 2. At the top: full alignment of the sequencing result with the cloned part in biobrick backbone pSB1C3-6xHis-Smt3-DCD-1L-22 aa linker-CBM. Below, sequencing result with the VF2 primer (BBa_G00100) and at the bottom, sequencing result with the VR primer (BBa_G00101). Generated using Geneious version 10.1.3 (http://www.geneious.com, Kearse et al., 2012)) (1)

The sequences of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.

Once gene of interest is cloned and confirmed with sequencing results, expression and purification experiments are performed. After it is proven that the system is functioning as intended in small scale expression, large scale expression experiments are performed in order to obtain larger yields of protein of interest. (Figure 5)

2. Small scale Production

2.1 Cultivations and Induction of protein expression

For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells https://www.neb.com/products/c2566-t7-express-competent-e-coli-high-efficiency) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C until it reached the OD600 value ~0,51. When finished growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking.


2.2 Purification

Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent (https://www.thermofisher.com/order/catalog/product/78248).

After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) started the protein purification. Loaded the the samples onto the spin columns and centrifuged at 1600 rpm for 5 minutes. Followed by Washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). Eluted the proteins in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). Stored the whole eluate in glycerol (300 μl of eluate + 300 μl of 50 % glycerol). Stored the used spin columns soaked in 0,1 M EDTA solution, at +4 °C. The samples from different flow throughs and elution were then analysed using SDS PAGE


2.3 SDS-Page of protein purification

Following small scale protein expression Qiagen Ni-NTA spin columns are used for purification. From different steps of purification, such as washing and elution, samples are loaded on SDS-PAGE along with samples collected from the small scale expression culture. SDS-PAGE image (Figure 4.) shows that after induction of expression with IPTG, the band gets corresponding to gene of interest gets thicker gradually, from initial (well 1) to 4 hours (well 3). It proves that the T7 promoter system works as intended, without promoter leakage. Although, there is a strong band in both lysate(well 4) and pellet (well 5) suggesting that protein of interest was partially precipitated. Soluble portion of the protein seen in lysate is successfully purified and can be seen in well 7 and 8.


Figure 3. SDS-Page image from small scale expression of His6x-Smt3-DCD1L-22 Linker-CBM construct (36.910 kDa) M: Marker (PageRuler™ Prestained Protein Ladder, Thermo Fisher) 1: Non-induced, 2: 2 hours of induction, 3: 4 hours of induction, 4: Lysate, 5: Pellet, 6: Flow through, 7: Eluate 1, 8: Eluate 2


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 127
    Illegal BglII site found at 410
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
Parameters
None