Coding
sfGFP11

Part:BBa_K2009820

Designed by: Yin Wu   Group: iGEM16_USTC   (2016-09-14)
Revision as of 14:03, 14 September 2016 by Verweile (Talk | contribs)

introduction

sfGFP11 length: 48bp Derived from:synthesis from Sangon

sfGFP11——PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3.

before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.

We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don’t need external chemical reagents or substrates. Finally we find away to accomplish this goal—— dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.

Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste´phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)

Part sequence

agagaccacatggtccttcatgagtatgtaaatgctgctgggattaca (All the sequence has been testified by Sangon)

[edit]
Categories
Parameters
None