Software error:
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 11. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 11. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Status: 500
Content-type: text/html
Software error:
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
GFP with His tag at the C-terminus and the E-coil at the N-terminus behind an IPTG induced promoter to use it as reporter for the E- and K-coil [http://2012.igem.org/Team:Wageningen_UR/Coil_system Plug and Apply system]
Usage and Biology
The E-coil present in this reporter protein is one part of the Plug and Apply (PnA) system consisting of a combination of E- and K-coil. These coils consist of α-helical repeats and have a strong affinity to each other due to electrostatic interactions (with K-coil positively charged and E-coil negatively charged). Using this system one can bind two proteins noncovalently but specifically to each other. This brick can be used for confirmation of the Plug and Apply system using E- and K-coils as well as for detection of proteins that can be fused to the K-coil.
To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.
name | sequence | translated |
K-coil (counterpart) | aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag | KIAALKEKIAALKEKIAALKE |
E-coil (present in the brick) | gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa | EIAALEKEIAALEKEIAALEK |
Source
The biobrick BBa_I13522 was used as a template for the mutations.
Usage and Biology
Sequence and Features Status: 500 Content-type: text/html
Software error:
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Software error:
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84. Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12. Compilation failed in require at /websites/parts.igem.org/cgi/extensions/part_box.cgi line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/extensions/part_box.cgi line 9.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.