Part:BBa_K091107:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQ814db4313b15ef02-partinfo-00000000-QINU

• SarahV, Kuleuven iGEM team 2011

We transformed Bba_K091107 (=pLux/CI promotor) in DH5α-cells, followed by a minipreparation. Next we did a restriction digest with EcoRI and SpeI. Since the pSB1A2 vector is 2079bp and the Lux/CI promoter should be 57bp, we expect a fragment of 57bp, one of 2079 and one of 2136bp. However, we see a fragment of 200bp and one of ±2000bp.

;

UNIQ814db4313b15ef02-partinfo-00000002-QINU

Andrew Kirk, undergraduate, Penn State iGEM 2010

Two Lux-inducible promoters that were already on the registry (K091107 and K091146) were characterized. Because these promoters require AHL and LuxR in order to activate, a construct was created that consisted of a Lux promoter followed by RFP, and a constitutive promoter followed by the LuxR gene. LuxR was expected to be present in excess so that the limiting factor would be AHL. The coding sequences for LuxR and RFP were preceded by the standard RBS B0034. The LuxR part used was K376010, which was just added to the registry by Penn State 2010. Using the Voigt RBS calculator, it was predicted that the translation initiation rate for expression of this gene was 246720 au.

The AHL used was OC6-homoserine lactone. It was added to samples in a 96-well plate in concentrations of 0, .1, 1, 10, 100 and 1000nM.

The results shown below and [http://2010.igem.org/Team:Penn_State/Project#Lux_Promoter_Characterization on our wiki] show no trend in protein expression based on concentration of OC6-homoserine lactone. More research is warranted to provide information about what are the best conditions for chemically inducing the Lux promoters.

In addition, sequencing results indicated that the intended sequence for K091107 was actually substituted for

AACCGTGAAAATCAAAATAGCATAAATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTT

ATGAACAAATTAAAAGCAGAAATACATTTAACACCGTGCGTGTTGAAGATTTTACCTCTGGCGGTGATAA

It would be helpful to know if any other teams experienced similar results.