![](https://parts.igem.org/images/partbypart/icon_plasmid_backbone.png)
Part:pSB1K16
Gateway entry vector for gene cassette (L1L2)
Made by MIT 2010 iGEM Team.
The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.
Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the entry vectors. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.
MammoBlock gene entry vectors are defined by the presence of attL1 and attL2 recombination sites flanking the gene insert. We require that MammoBlock L1L2 Gene Vectors contain the following sequence structure around the insert (or ‘part’), which allow for insertion of the gene directly in behind the promoter during the Gateway© reaction :
5’ _attL1 site_--------Insert--------_attL2 site_3’
att_L1 Recombination Site Sequence:
5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT3’
att_L2 Recombination Site Sequence:
5’ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG3’
An example is shown in Figure 1 of an L1L2 MammoBlock part containing the gene fluorescent protein EGFP. We submit this vector, with biobrick designation pSB1K16 as the first MammoBlock backbone for promoter entry vectors.
Insert ‘Part’ Sequencing Primers for pSB1K16:
- M13 (-20) forward primer: 5’CATTTTGCTGCCGGTC 3’
- M13 reverse primer: 5’CAGGAAACAGCTATGAC 3’
- pSB1K16 Bacterial Antibiotic Resistance: Kanamycin
Please see our RFC document for full MammoBlock Documentation. [1]
A MammoBlock L4R1 Promoter Part, L1L2 Gene Part, and appropriate destination vector are combined in a multi-site Gateway© reaction to yield the final expression vector. (Figure 2)
We present MammoBlock recombination cloning as the mammalian standard for part-based assembly of expression vectors. The variety of methods for creating entry vectors, the robust nature of the reaction, and the quick time for completion combine to make this assembly a quick and efficient counterpart to the BioBricking standard.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal NheI site found at 2115
Illegal NheI site found at 2381 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal SapI.rc site found at 1992
None |