Difference between revisions of "Part:BBa K4497022"

Revision as of 13:40, 13 October 2022

MESA GFPnb-L2-TEV

This part is one of eight receptor parts that can be used for the the MESA receptor system of the iGEM Team Munich 2022 [1]. The receptors are made of a nanobody receptor for either GFP or mCherry, followed by two different link lengths, and an intracellular domain of either the transcription factor tTA or the protease TEV. tTA is cut off the receptor on contact with the TEV protease. The release of the transcription factor can be used to induce reporters or other expression in the cell of interest.

Design & Cloning

Design

This part specifically is made of the following components:

• GFP nanobody receptor (Part:BBa_K4497008)
  • IL-11 Signaling Sequence (Part:BBa_K4497003): Signaling Sequence for Cell surface expression
  • Myc-tag (Part:BBa_K112502): Myc epitope tag that enables surface expression detection using immunofluorescence labeling
  • Anti-GFP nanobody (Part:BBa_K4497002): a nanobody capable of binding GFP
• Membrane linker 2(Part:BBa_K4497016): A short linker between the nanobody and transmembrane domain
• tTA signaling MESA domain (Part:BBa_K4497010)
  • CD 28 transmembrane domain (Part:BBa_K4497004): transmembrane anchor for the MESA system
  • TEV Protease Recognition Sequence (M) (Part:BBa_K4497006): Sequence cut by TEV protease
  • Tetracycline-Induced Transactivator tTA (Part:BBa_K4497007): Transcription factor of our MESA system
  • EBFP2 (Part:BBa_K511100): BFP reporter fused to tTA allowing measuring expression and correction of other linked measurements to MESA surface expression.

Cloning

We created this part using restriction cloning. The backbone pcDNA3.4 with the GFP nanobody receptor sequence was created by digesting the plasmid pcDNA3.1-myc-GFPnb-gp130 using XbaI, EcoRI. The plasmid was kindly provided to us from Prof. Scheller [1].

The insert containing the membrane linker and tTA signaling MESA domain was created by PCR on the plasmid V2-MESA-35F-M-tTA (Addgene #84502 [2]). The PCR product was digested using XbaI, EcoRI before ligation and transformation into E.coli.

• Primer F: TAAGCAGAATTCGGAGGAGACTACAAGGACGATG
• Primer R: TAAGCATCTAGATTACTTGTACAGCTCGTCCATG

MESA System

Please find an in-depth analysis of the usage of this part at the page of MESA GFPnb-L1-tTA: Part:BBa_K4497017

These are all the MESA parts:

• G1TA: Part:BBa_K4497017
• G1TEV: Part:BBa_K4497018
• M1TA: Part:BBa_K4497019
• M1TEV: Part:BBa_K4497020
• G2TA: Part:BBa_K4497021
• G2TEV: Part:BBa_K4497022
• M2TA: Part:BBa_K4497023
• M2TEV: Part:BBa_K4497024

Usage and Biology

We used this part in mammalian cell culture: HEK293T, Cos7 in a S1 safety level lab.

Sequence and Features